This is the local page (enwiki) of the project "[[de:Benutzer:Stefan Kühn/Check Wikipedia|Check Wikipedia]]".
* Data from the CW-database at the time: '''2010-03-07 00:01''' (GMT, Toolserver)
* More features and statistics in the <span style="background-color:yellow;">[http://toolserver.org/~sk/cgi-bin/checkwiki/checkwiki.cgi new interface]</span>
* In the future this output will not be supported. Please change your page into your local projectpage. All data will be available in the new interface.
* Daily you can found an update of this page [http://toolserver.org/~sk/checkwiki/enwiki/enwiki_output_for_wikipedia.html here].
* Please change the translation page so that you can work with the translation in the new interface (XHTML).
== Highest Priority ==
=== Code not correct end ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:List of homing endonuclease cutting sites]] || <nowiki><code> 5' AAATTGCTTGCAAACAGCTATTACGGCTAT </br> 3' </nowiki>
|-
| [[:List of restriction enzyme cutting sites]] || <nowiki><code> 5' CGGCCG </br> 3' GCCGGC| <code> 5' ---C </nowiki>
|}
=== Headlines all start with three "=" (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1 E+40 m³]] || <nowiki>====1 E+40 m³ to 1 E+43 m³====</nowiki>
|-
| [[:1999 in comics]] || <nowiki>===February===</nowiki>
|-
| [[:2003 Big Ten Conference Men's Basketball Tournament]] || <nowiki>===Bracket===</nowiki>
|-
| [[:2009 San Francisco 49ers regular season results]] || <nowiki>===Week 1: at Arizona Cardinals===</nowiki>
|-
| [[:2009 US Open (tennis)/Day-by-day summaries]] || <nowiki>===Day 1 (August 31)===</nowiki>
|-
| [[:2010 Australian Open/Day-by-day summaries]] || <nowiki>=== Hit for Haiti (17 January) ===</nowiki>
|-
| [[:2010 Copa Bimbo]] || <nowiki>===Bracket===</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Motion Picture===</nowiki>
|-
| [[:300 (disambiguation)]] || <nowiki>===In media===</nowiki>
|-
| [[:3D Stereo View]] || <nowiki>===3D Stereo View===</nowiki>
|-
| [[:3rd Degree Burns: The Music of TNA Wrestling Vol. 1]] || <nowiki>===Track listing===</nowiki>
|-
| [[:4-4 defense]] || <nowiki>===Defensive Tackles===</nowiki>
|-
| [[:4676th Air Defense Group]] || <nowiki>===Lineage===</nowiki>
|-
| [[:Bargn Farmaceutici Phils Co]] || <nowiki>===History===</nowiki>
|-
| [[:Breaking Heart]] || <nowiki>===Repackage===</nowiki>
|-
| [[:Dana Summers]] || <nowiki>===External Links===</nowiki>
|-
| [[:Erik Reitzel]] || <nowiki>=== First prize projects ===</nowiki>
|-
| [[:Gibsonten]] || <nowiki>=======================================</nowiki>
|-
| [[:Kokubo]] || <nowiki>===People named Kokubo===</nowiki>
|-
| [[:List of DirecTV channels International Packages (North America)]] || <nowiki>===Color Legend===</nowiki>
|-
| [[:Noof writers forums]] || <nowiki>====Noof Writers Forums====</nowiki>
|-
| [[:Picturesque America]] || <nowiki>====Bibliography====</nowiki>
|-
| [[:Robert de Eglesfield]] || <nowiki>=====King's clerk=====</nowiki>
|-
| [[:Varapuzha Bridge]] || <nowiki>=====References=====</nowiki>
|-
| [[:Yasmien Kurdi Discography]] || <nowiki>===Albums===</nowiki>
|}
=== Headlines start with one "=" (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:9mm Parabellum Bullet]] || <nowiki>=Formation and Early Releases (2005 - 2006)=</nowiki>
|-
| [[:Centered System of Sets]] || <nowiki>=Definition=</nowiki>
|-
| [[:Company Level Intelligence Cell]] || <nowiki>=Source=</nowiki>
|-
| [[:Crab Cay]] || <nowiki>=Ruins=</nowiki>
|-
| [[:Fellow]] || <nowiki>=Academia=</nowiki>
|-
| [[:International football players with dual citizenship]] || <nowiki>=Europe=</nowiki>
|-
| [[:IUCN Red List conservation dependent species]] || <nowiki>=[[Animalia]]=</nowiki>
|-
| [[:IUCN Red List near threatened species]] || <nowiki>=[[Animalia]]=</nowiki>
|-
| [[:List of future AMD microprocessors]] || <nowiki>=Desktop processors=</nowiki>
|-
| [[:List of television channels available in Ireland]] || <nowiki>=TV Channels from Ireland=</nowiki>
|-
| [[:List of US politicians with Confederate ancestry]] || <nowiki>=References=</nowiki>
|-
| [[:Margarita (given name)]] || <nowiki>=See also==</nowiki>
|-
| [[:Marissa Delgado]] || <nowiki>=TV SHOWS=</nowiki>
|-
| [[:Midreshet Aviv]] || <nowiki>=External Links=</nowiki>
|-
| [[:N. T. Rama Rao Jr.]] || <nowiki>= Career =</nowiki>
|-
| [[:Operation Al Majid]] || <nowiki>=Source=</nowiki>
|-
| [[:Operation Defeat Al Qaeda in the North]] || <nowiki>=Source=</nowiki>
|-
| [[:Operation Guardian Tiger IV]] || <nowiki>=Source=</nowiki>
|-
| [[:Oron (state)]] || <nowiki>=Geography and government=</nowiki>
|-
| [[:Porta del Sol]] || <nowiki>=Attractions=</nowiki>
|-
| [[:Rock Shop Music Group]] || <nowiki>=References=</nowiki>
|-
| [[:Samsung SGH-T100]] || <nowiki>= References =</nowiki>
|-
| [[:Skybuilt Power]] || <nowiki>= Summary =</nowiki>
|-
| [[:Tammy Williams]] || <nowiki>= College =</nowiki>
|-
| [[:Vulnerable species]] || <nowiki>=[[Animalia]]=</nowiki>
|}
=== Headlines start with three "=" and later with level two ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:3rd African Movie Academy Awards]] || <nowiki>=== Major Awards ===</nowiki>
|-
| [[:3rd Single Infantry Battalion (Estonia)]] || <nowiki>===Order of battle===</nowiki>
|-
| [[:40th Infantry Division (United Kingdom)]] || <nowiki>===World War I ===</nowiki>
|-
| [[:42d Expeditionary Airlift Squadron]] || <nowiki>===Operations<ref name="AFHRA 42 EAS Page"/>===</nowiki>
|-
| [[:461st Bombardment Wing]] || <nowiki>=== Lineage ===</nowiki>
|-
| [[:4735th Air Defense Group]] || <nowiki>=== Operations===</nowiki>
|-
| [[:47th Air Division]] || <nowiki>=== Lineage ===</nowiki>
|-
| [[:497th Air Refueling Wing]] || <nowiki>===Lineage===</nowiki>
|-
| [[:4th California Infantry]] || <nowiki>===4th California Regiment of Infantry Commanders===</nowiki>
|-
| [[:American Idiot World Tour]] || <nowiki>===Setlist===</nowiki>
|-
| [[:Atlanta Student Movement]] || <nowiki>=== [[Appeal for Human Rights]] ===</nowiki>
|-
| [[:Committee on the Appeal for Human Rights]] || <nowiki>=== Members of COAHR ===</nowiki>
|-
| [[:Einstürzende Neubauten logo]] || <nowiki>===Origin and meaning===</nowiki>
|-
| [[:Hillvalleyhigh]] || <nowiki>===Etymology===</nowiki>
|-
| [[:List of IIHF World Championships by Attendance]] || <nowiki>===List===</nowiki>
|-
| [[:Murder (Norway)]] || <nowiki>==== Miscellaneous forms of murder ====</nowiki>
|-
| [[:Murder (Romanian law)]] || <nowiki>===Degrees of murder===</nowiki>
|-
| [[:Murder (United States law)]] || <nowiki>====Degrees of murder in the United States==== </nowiki>
|-
| [[:Nuestra Belleza Latina 2008]] || <nowiki>===Changes===</nowiki>
|-
| [[:Nuestra Belleza Latina 2010]] || <nowiki>===Changes===</nowiki>
|-
| [[:Rink Hockey Bundesliga]] || <nowiki>===List of Winners===</nowiki>
|-
| [[:Seismic Micro-Technology]] || <nowiki>===Business locations===</nowiki>
|-
| [[:The Coventry Martyrs]] || <nowiki>===Lollardy in 15th-century Coventry===</nowiki>
|-
| [[:Third North American blizzard of 2010]] || <nowiki>===Impact===</nowiki>
|-
| [[:Xyriel Manabay]] || <nowiki>===Television shows===</nowiki>
|}
=== ISBN wrong checksum in ISBN-10 ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1890s]] || <nowiki>0930973193</nowiki> || <nowiki>3 vs. 4 (224 mod 11) </nowiki>
|-
| [[:1st Polish Armoured Regiment]] || <nowiki>83-011863-9-3</nowiki> || <nowiki>3 vs. 9 (218 mod 11) </nowiki>
|-
| [[:320 mm Model 1934 naval gun]] || <nowiki>385-0-7247-0-3</nowiki> || <nowiki>3 vs. 0 (165 mod 11) </nowiki>
|-
| [[:37th New Jersey Volunteer Infantry Regiment]] || <nowiki>094441354X</nowiki> || <nowiki>X vs. 4 (169 mod 11) </nowiki>
|-
| [[:381mm / 50 Model 1934 naval gun]] || <nowiki>385-0-7247-0-3</nowiki> || <nowiki>3 vs. 0 (165 mod 11) </nowiki>
|-
| [[:3D optical data storage]] || <nowiki>1-12-635490-1</nowiki> || <nowiki>1 vs. 2 (178 mod 11) </nowiki>
|-
| [[:3rd (Lahore) Division]] || <nowiki>0-7137-1869-4</nowiki> || <nowiki>4 vs. 2 (255 mod 11) </nowiki>
|-
| [[:4-6-2]] || <nowiki>3-7002-0431-X</nowiki> || <nowiki>X vs. 0 (88 mod 11) </nowiki>
|-
| [[:4-6-2]] || <nowiki>91-85089-13-2</nowiki> || <nowiki>2 vs. 3 (201 mod 11) </nowiki>
|-
| [[:457th Air Expeditionary Group]] || <nowiki>0-9648926-0-2</nowiki> || <nowiki>2 vs. 10 (208 mod 11) </nowiki>
|-
| [[:49th Operations Group]] || <nowiki>1-84176-785-7</nowiki> || <nowiki>7 vs. 9 (262 mod 11) </nowiki>
|-
| [[:5"/25 caliber gun (United States)]] || <nowiki>0385-0-7247-0</nowiki> || <nowiki>0 vs. 3 (201 mod 11) </nowiki>
|-
| [[:5"/51 caliber gun]] || <nowiki>0385-0-7247-0</nowiki> || <nowiki>0 vs. 3 (201 mod 11) </nowiki>
|-
| [[:Aspatria RUFC]] || <nowiki>07137 1838 7</nowiki> || <nowiki>7 vs. 2 (222 mod 11) </nowiki>
|-
| [[:Bartholomew the Apostle]] || <nowiki>0-85229-633-0</nowiki> || <nowiki>0 vs. 9 (196 mod 11) </nowiki>
|-
| [[:Bartholomew the Apostle]] || <nowiki>0-385-49663-4</nowiki> || <nowiki>4 vs. 10 (241 mod 11) </nowiki>
|-
| [[:Beqir Balluku]] || <nowiki>0253203257</nowiki> || <nowiki>7 vs. 2 (123 mod 11) </nowiki>
|-
| [[:Beqir Balluku]] || <nowiki>0253203257</nowiki> || <nowiki>7 vs. 2 (123 mod 11) </nowiki>
|-
| [[:Diary of a Wimpy Kid: My Last Year]] || <nowiki>0108153674</nowiki> || <nowiki>4 vs. 3 (201 mod 11) </nowiki>
|-
| [[:Digital art]] || <nowiki>2-7385-7223-0</nowiki> || <nowiki>0 vs. 5 (181 mod 11) </nowiki>
|-
| [[:Digital art]] || <nowiki>2-7385-7223-0</nowiki> || <nowiki>0 vs. 5 (181 mod 11) </nowiki>
|-
| [[:Efigenio Ameijeiras]] || <nowiki>0277979037</nowiki> || <nowiki>7 vs. 10 (230 mod 11) </nowiki>
|-
| [[:Jack Kirby]] || <nowiki>6194123064</nowiki> || <nowiki>4 vs. 0 (143 mod 11) </nowiki>
|-
| [[:John Barbirolli]] || <nowiki>0-413-40940-0</nowiki> || <nowiki>0 vs. 6 (138 mod 11) </nowiki>
|-
| [[:List of English football champions]] || <nowiki>0-1410-1582-8</nowiki> || <nowiki>8 vs. 9 (141 mod 11) </nowiki>
|}
=== ISBN wrong checksum in ISBN-13 ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:20000 Varuna]] || <nowiki>987-0-8165-2755-7</nowiki> || <nowiki>7 vs. 5 </nowiki>
|-
| [[:Battle of Mohács]] || <nowiki>0075434536776</nowiki> || <nowiki>6 vs. 7 </nowiki>
|-
| [[:Biblical inerrancy]] || <nowiki>978-0-10-280290-3</nowiki> || <nowiki>3 vs. 0 </nowiki>
|-
| [[:Bread]] || <nowiki>9780822338335</nowiki> || <nowiki>5 vs. 8 </nowiki>
|-
| [[:Canada–Haiti relations]] || <nowiki>978-2-2620154-0-6</nowiki> || <nowiki>6 vs. 4 </nowiki>
|-
| [[:Change management]] || <nowiki>978-0-9767359-0-3</nowiki> || <nowiki>3 vs. 8 </nowiki>
|-
| [[:Diary of a Wimpy Kid: My Last Year]] || <nowiki>9780713672576</nowiki> || <nowiki>6 vs. 2 </nowiki>
|-
| [[:E-scape]] || <nowiki>978-1-904158-63-3</nowiki> || <nowiki>3 vs. 9 </nowiki>
|-
| [[:Fourth Realm Trilogy]] || <nowiki>978-0-385-51439-9</nowiki> || <nowiki>9 vs. 2 </nowiki>
|-
| [[:Haiti]] || <nowiki>978-2-2620154-0-6</nowiki> || <nowiki>6 vs. 4 </nowiki>
|-
| [[:Henry Kissinger]] || <nowiki>973-3-940405-70-8</nowiki> || <nowiki>8 vs. 3 </nowiki>
|-
| [[:History of the Luftwaffe (1933–1945)]] || <nowiki>978-1-903223-71-7</nowiki> || <nowiki>7 vs. 0 </nowiki>
|-
| [[:Mohammad Ataul Karim]] || <nowiki>978-1-4200-5474-0</nowiki> || <nowiki>0 vs. 3 </nowiki>
|-
| [[:Mohammad Ataul Karim]] || <nowiki>978-1-4200-6131-3</nowiki> || <nowiki>3 vs. 4 </nowiki>
|-
| [[:Niccolò Machiavelli]] || <nowiki>978-0-934941-003</nowiki> || <nowiki>3 vs. 6 </nowiki>
|-
| [[:Operation Barbarossa]] || <nowiki>9870375724718</nowiki> || <nowiki>8 vs. 6 </nowiki>
|-
| [[:Paris Métro]] || <nowiki>978-1-85414-322-0</nowiki> || <nowiki>0 vs. 8 </nowiki>
|-
| [[:Phrarajbhavanavisudh]] || <nowiki>978-974-94783-0-4</nowiki> || <nowiki>4 vs. 1 </nowiki>
|-
| [[:QF 12 pounder 12 cwt naval gun]] || <nowiki>978-1-84067-529-2</nowiki> || <nowiki>2 vs. 0 </nowiki>
|-
| [[:Robert Siciliano]] || <nowiki>978-0-07-069614-0</nowiki> || <nowiki>0 vs. 3 </nowiki>
|-
| [[:Samuel Fox (1781-1868)]] || <nowiki>978-1850723672</nowiki> || <nowiki>2 vs. 7 </nowiki>
|-
| [[:Scattered disc]] || <nowiki>987-0-8165-2755-7</nowiki> || <nowiki>7 vs. 5 </nowiki>
|-
| [[:Singaporean Hokkien]] || <nowiki>9787561516924</nowiki> || <nowiki>4 vs. 8 </nowiki>
|-
| [[:Theoren Fleury]] || <nowiki>978-1-55469-239-3</nowiki> || <nowiki>3 vs. 2 </nowiki>
|-
| [[:Virgin birth of Jesus]] || <nowiki>978-0-10-280290-3</nowiki> || <nowiki>3 vs. 0 </nowiki>
|}
=== ISBN wrong length ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1829 in New Zealand]] || <nowiki>0 4614 008 5</nowiki> || <nowiki>9 </nowiki>
|-
| [[:2001 anthrax attacks]] || <nowiki>10</nowiki> || <nowiki>2 </nowiki>
|-
| [[:2009 in poetry]] || <nowiki>978184777016</nowiki> || <nowiki>12 </nowiki>
|-
| [[:2010 in poetry]] || <nowiki>978-1-9046140-96-8</nowiki> || <nowiki>14 </nowiki>
|-
| [[:All Things Must Pass]] || <nowiki>094671950</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Cian d'Fhearaibh Bolg]] || <nowiki>0 954798 1 3</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Felix Mendelssohn]] || <nowiki>089579293</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Fra Angelico]] || <nowiki>0 500 231236 2</nowiki> || <nowiki>11 </nowiki>
|-
| [[:Friedrich Hecker]] || <nowiki>13-978-1-932250-27-5</nowiki> || <nowiki>15 </nowiki>
|-
| [[:Kate L Leser]] || <nowiki>13 978-87-7241-282-5</nowiki> || <nowiki>15 </nowiki>
|-
| [[:Nothing Lasts Forever Anymore]] || <nowiki>848725987</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Nothing Lasts Forever Anymore]] || <nowiki>848725995</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Religious conversion]] || <nowiki>90</nowiki> || <nowiki>2 </nowiki>
|-
| [[:Trinity]] || <nowiki>853313245</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853313245</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853312702</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853312702</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853313245</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853313245</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853312702</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>853312702</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Trinity]] || <nowiki>139780830815050</nowiki> || <nowiki>15 </nowiki>
|-
| [[:Warren Oates]] || <nowiki>0</nowiki> || <nowiki>1 </nowiki>
|-
| [[:Warren Oates]] || <nowiki>0</nowiki> || <nowiki>1 </nowiki>
|-
| [[:Yarlung Valley]] || <nowiki>0-86171-87-8</nowiki> || <nowiki>9 </nowiki>
|}
=== ISBN wrong position of X ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1813 in New Zealand]] || <nowiki>978 1901231 81 X </nowiki>
|-
| [[:4-8-0]] || <nowiki>87749-150-X </nowiki>
|-
| [[:Boulton Paul Defiant]] || <nowiki>X-9999-0042-X </nowiki>
|-
| [[:Constitutional convention (political custom)]] || <nowiki>19876202X </nowiki>
|-
| [[:Culture of Iran]] || <nowiki>1568591772 x </nowiki>
|-
| [[:Fauna of Scotland]] || <nowiki>0224033961X </nowiki>
|-
| [[:Formal language]] || <nowiki>0-201-029880-X </nowiki>
|-
| [[:Friedrich Nietzsche]] || <nowiki>0-08078-8085-X </nowiki>
|-
| [[:Geology of the North Sea]] || <nowiki>0-4444-50611-X </nowiki>
|-
| [[:George Gershwin]] || <nowiki>10075675660X </nowiki>
|-
| [[:Harrison Slater]] || <nowiki>0-150100580-X </nowiki>
|-
| [[:Ivan Engler]] || <nowiki>388778-2002x </nowiki>
|-
| [[:Jan Zweyer]] || <nowiki>978-389425212X </nowiki>
|-
| [[:Memorial Grounds]] || <nowiki>1 8999890 19 X </nowiki>
|-
| [[:Oshki]] || <nowiki>10075465740X </nowiki>
|-
| [[:Polyploidy]] || <nowiki>10 0-471-69939-X </nowiki>
|-
| [[:Shinkyoku Sōkai Polyphonica]] || <nowiki>978479733780X </nowiki>
|-
| [[:Sinn Féin]] || <nowiki>55207862X </nowiki>
|-
| [[:Statistical machine translation]] || <nowiki>0-12-36280-X </nowiki>
|-
| [[:Steamtown Peterborough Museum]] || <nowiki>978-1-84677-066-x </nowiki>
|-
| [[:Supermarine Spitfire]] || <nowiki>1-885605-702-X </nowiki>
|-
| [[:Supermarine Spitfire operational history]] || <nowiki>1-885605-702-X </nowiki>
|-
| [[:The Music Man]] || <nowiki>10-083718486X 1975 </nowiki>
|-
| [[:The Picture of Dorian Gray]] || <nowiki>978-0140433187-X </nowiki>
|-
| [[:White House]] || <nowiki>698-10546-X </nowiki>
|}
=== ISBN wrong syntax (AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Ernest Hemingway]] || <nowiki>-10 </nowiki>
|-
| [[:Human-readable medium]] || <nowiki>-13 </nowiki>
|-
| [[:Machine-readable]] || <nowiki>-13 </nowiki>
|-
| [[:Machine-readable medium]] || <nowiki>-13 </nowiki>
|}
=== Reference duplication (partial AWB) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alexander Hamilton]] || <nowiki><ref>Chernow, p. 63.</ref> </nowiki>
|-
| [[:Atlanta Student Movement]] || <nowiki><ref>[http://www.publicbroadcasting.net/wabe/news.newsmain?action=article&ARTICLE_ID=980196§ionID=223 Interview (Audio) with Lonnie King] - PBA Online</ref> </nowiki>
|-
| [[:Berthelinia caribbea]] || <nowiki><ref>http://www.seaslugforum.net/factsheet/bertcari</ref> </nowiki>
|-
| [[:Berthelinia chloris]] || <nowiki><ref>http://www.sealifebase.org/summary/SpeciesSummary.php?id=87575</ref> </nowiki>
|-
| [[:Berthelinia pseudochloris]] || <nowiki><ref>http://seaslugsofhawaii.com/species/Berthelinia-pseudochloris-a.html</ref> </nowiki>
|-
| [[:Brad Lamm]] || <nowiki><ref>{{cite news | name = “Former Addict” | last = Browning-Blas | first = Kristen | title = Former addict now preaches a new family of intervention | publisher = [[The Denver Post]] | date = June 1, 2009 | url = http://www.denverpost.com/lifestyles/ci_12486264 | accessdate = 2010-02-12}}</ref> </nowiki>
|-
| [[:Carnism]] || <nowiki><ref>"Mentality of Meat"</ref> </nowiki>
|-
| [[:Clyde Rucker]] || <nowiki><ref>http://pr.quiznos.com/quiznos-names-clyde-rucker-executive-vice-president-and-chief-administrative-officer.ia Last accessed 25 February 2010</ref> </nowiki>
|-
| [[:Doors Open Ottawa]] || <nowiki><ref>[http://www.ottawa.ca/residents/heritage/doorsopen/about_en.html About Doors Open Ottawa]</ref> </nowiki>
|-
| [[:Elections in Connecticut]] || <nowiki><ref>http://www.sots.ct.gov/sots/lib/sots/electionservices/electionresults/2008_election_results/constitutional_questions_on_the_ballot.pdf</ref> </nowiki>
|-
| [[:Footage Recorder]] || <nowiki><ref>[http://www.footagerecorder.com/index.php/recorder Footage Recorder - Capture and archive your video]</ref> </nowiki>
|-
| [[:Gilbert Bayes]] || <nowiki><ref>Public sculpture of Glasgow By Raymond McKenzie, Gary Nisbet</ref> </nowiki>
|-
| [[:John Barr (shinty)]] || <nowiki><ref>[http://www.skyecamanachd.com/default.aspx.locid-087new193.Lang-EN.htm]</ref> </nowiki>
|-
| [[:Leonard Tan Khang Hwee]] || <nowiki><ref>http://www.straitstimes.com/SME%2BSpotlight/SME%2BHighlights/Story/STIStory_451797.html</ref> </nowiki>
|-
| [[:Mike McCready (music entrepreneur)]] || <nowiki><ref>http://www.mikemccready.com/El%20Punt%2001.pdf</ref> </nowiki>
|-
| [[:Modern Female Ninja: Flesh Hell]] || <nowiki><ref>{{cite web |url=http://www.jmdb.ne.jp/1968/cr003100.htm|title=現代くノ一肉地獄|accessdate=2010-02-26|language=Japanese|publisher=[[Japanese Movie Database]]}}</ref> </nowiki>
|-
| [[:Necessity defense (Kansas)]] || <nowiki><ref>[http://www.independent.co.uk/opinion/commentators/jacob-appel-allowing-a-manslaughter-defence-brings-risk-of-anarchy-1866128.html Allowing a manslaughter defence brings risk of anarchy ], The Independent, Jan. 13, 2010.</ref> </nowiki>
|-
| [[:Ohm Krüger]] || <nowiki><ref>Welch, ''Propaganda'', p. 231.</ref> </nowiki>
|-
| [[:Old age and driving]] || <nowiki><ref>http://www.axcessnews.com/index.php/articles/show/id/19710</ref> </nowiki>
|-
| [[:Pat Hanna]] || <nowiki><ref>http://www.dnzb.govt.nz/dnzb/alt_essayBody.asp?essayID=4H14</ref> </nowiki>
|-
| [[:Psammobates]] || <nowiki><ref>[http://www.jcvi.org/reptiles/search.php?submit=Search&exact%5B%5D=genus&genus=Psammobates JCVI.org] (Retrieved Feb. 24, 2010.)</ref> </nowiki>
|-
| [[:Saturn Returns (Film)]] || <nowiki><ref>{{cite web|url=http://www.saturnreturnsfilm.com/story |title=Saturn Returns (2009): Official Website}}</ref> </nowiki>
|-
| [[:Titanium ring]] || <nowiki><ref>Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International. p. 11. ISBN 0871703092.</ref> </nowiki>
|-
| [[:VEXNEWS]] || <nowiki><ref>{{cite news|url=http://news.ninemsn.com.au/national/873597/fevola-harassed-reporter-at-brownlow|title=Fevola 'harassed reporter at Brownlow'|date=9 October 2009|work=Ninemsn|accessdate=24 February 2010}}</ref> </nowiki>
|-
| [[:Whorecore]] || <nowiki><ref>http://www.myspace.com/wxcore</ref> </nowiki>
|}
=== Section without content ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1873 in Germany]] || <nowiki>==Sport==</nowiki>
|-
| [[:1874 in rail transport]] || <nowiki>==Births==</nowiki>
|-
| [[:1960 Saskatchewan Roughriders season]] || <nowiki>==Offseason==</nowiki>
|-
| [[:2010 Horizon League Men's Basketball Tournament]] || <nowiki>==Honors==</nowiki>
|-
| [[:American Idiot World Tour]] || <nowiki>==References==</nowiki>
|-
| [[:Bellator 15]] || <nowiki>===Non-Tournament bouts===</nowiki>
|-
| [[:Big 8 Conference (Missouri)]] || <nowiki>===Current members===</nowiki>
|-
| [[:Candidates of the Queensland state election, 1912]] || <nowiki>==By-elections==</nowiki>
|-
| [[:Channar (tribe)]] || <nowiki>== See also ==</nowiki>
|-
| [[:Global Aviation & Services Group]] || <nowiki>===Destinations===</nowiki>
|-
| [[:Goraho]] || <nowiki>== See also ==</nowiki>
|-
| [[:Hesbani]] || <nowiki>== See also ==</nowiki>
|-
| [[:Kamboh (name)]] || <nowiki>== External links ==</nowiki>
|-
| [[:Kunbhar]] || <nowiki>== See also ==</nowiki>
|-
| [[:Larik]] || <nowiki>== See also ==</nowiki>
|-
| [[:List of Transmetropolitan story arcs]] || <nowiki>==="21 Days in the City" #26===</nowiki>
|-
| [[:Mahesar]] || <nowiki>== See also ==</nowiki>
|-
| [[:March 2010 in rail transport]] || <nowiki>=== March 1 - March 6 ===</nowiki>
|-
| [[:Mirbahar]] || <nowiki>== See also ==</nowiki>
|-
| [[:One Eyed King]] || <nowiki>==Synopsis==</nowiki>
|-
| [[:Soviet Second League 1964]] || <nowiki>==League Standings==</nowiki>
|-
| [[:State Highway 11 (Kerala)]] || <nowiki>== Districts connected by State Highway ==</nowiki>
|-
| [[:State Highway 16 (Kerala)]] || <nowiki>==Districts connected by State Highway==</nowiki>
|-
| [[:Tagar (tribe)]] || <nowiki>== See also ==</nowiki>
|-
| [[:Third North American blizzard of 2010]] || <nowiki>===Impact===</nowiki>
|}
=== Square brackets not correct begin (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010 Gator Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Liberty Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Orange Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Outback Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Rose Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Sugar Bowl]] || <nowiki>2009-10 Bowl TV Ratings]]</nowiki>
|-
| [[:2010 Texas Rangers season]] || <nowiki>TR Sullivan MLB.com]]</nowiki>
|-
| [[:2Be3]] || <nowiki>Name = 2Be3| Img = Les 2 be 3.jpg|thumb|center]]</nowiki>
|-
| [[:353d Special Operations Group]] || <nowiki>the ground echelons of the 3d Fighter Squadron]]</nowiki>
|-
| [[:4.3.2.1]] || <nowiki>to be released in Spring 2010.<ref name="Empire]]</nowiki>
|-
| [[:40 (Ulster) Signal Regiment]] || <nowiki>and Antrim Artillery) Signal Squadron at [Lisburn]]</nowiki>
|-
| [[:40 Guns to Apache Pass]] || <nowiki>leaving Coburn and Sgt. Walker (Robert Brubaker]]</nowiki>
|-
| [[:404th Air Expeditionary Group]] || <nowiki>404th Air Expeditionary Group Factsheet]]</nowiki>
|-
| [[:5 Men and a Limo]] || <nowiki>intro to the ["[Theme from New York, New York]]</nowiki>
|-
| [[:Aeolidiella stephanieae]] || <nowiki>embryo.<br/>The total size is about 170 μm.]]</nowiki>
|-
| [[:Cui Guicong]] || <nowiki>of the five planets ([[Mercury]] (planet)|Mercury]]</nowiki>
|-
| [[:Defective Detective]] || <nowiki>one of whom is a member of Kammer Sieben]]</nowiki>
|-
| [[:Electronic Sports (disambiguation)]] || <nowiki>Dogfight Flight Simulator]]</nowiki>
|-
| [[:French airship Dixmude]] || <nowiki>Le ''Dixmude'']]</nowiki>
|-
| [[:Gospel of the Hebrews]] || <nowiki>of Thomas, Gospel of Peter, Gospel of Matthias]]</nowiki>
|-
| [[:Hillvalleyhigh]] || <nowiki>[http://www.jstor.org/stable/3739564 in JSTOR]]</nowiki>
|-
| [[:History of Rush]] || <nowiki>instrumentals#Neil Peart's drum solos|O Baterista]]</nowiki>
|-
| [[:Mike Bloomgren]] || <nowiki>State University alumni]]]]</nowiki>
|-
| [[:Solferino (Quintana Roo)]] || <nowiki>the [[paca]], the [ [turtle | turtles]]</nowiki>
|-
| [[:Undefined Statements]] || <nowiki>Shell Photo Shoot]]</nowiki>
|}
=== Square brackets not correct end (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2C-E]] || <nowiki>[[New Zealand has a catch-all Analogues section in Schedule 3 / Class C of their</nowiki>
|-
| [[:3-D film]] || <nowiki>[[In January 2008, 3ality Digital and National Geographic Entertainment released</nowiki>
|-
| [[:32nd Saturn Awards]] || <nowiki>[[Kyle Pratt] - ''[[Flightplan]]''*[[Laura Linney]] - ''[[The Exorcism Of Emily Rose]]''*[[Rache</nowiki>
|-
| [[:39th Infantry Division (United States)]] || <nowiki>[[Camp Beauregard, Louisiana, Louisiana, the Division was deployed to France but</nowiki>
|-
| [[:3GG]] || <nowiki>[[Dan Lyons (presenter)] & [[Ken]]| Networked (From Gold Coast)| 20 Minutes| 60 minutes|-</nowiki>
|-
| [[:3GG]] || <nowiki>[[Dan Lyons (presenter)] & [[Ken]]| Networked (From Gold Coast)| 20 Minutes| 60 minutes|-</nowiki>
|-
| [[:42nd (East Lancashire) Infantry Division]] || <nowiki>[[Rochdale].]Outlying detachments at Middleton and Todmorden.<br>disbanded Februar</nowiki>
|-
| [[:45th Academy Awards]] || <nowiki>[[''For the engineering of a computerized light valve monitoring system for motio</nowiki>
|-
| [[:46th Operations Group]] || <nowiki>[[http://www.afhra.af.mil/factsheets/factsheet.asp?id=9695 46th Operations Group</nowiki>
|-
| [[:Aéropostale (clothing)]] || <nowiki>[[The ''Aéropostale'' name is [[French language|French]] for ''"air mail"'' and</nowiki>
|-
| [[:Achievement Motivation Inventory]] || <nowiki>[[Category:Articles created via the Article Wizard]</nowiki>
|-
| [[:Alexander Hamilton]] || <nowiki>[[http://www.jstor.org/stable/1925345.pdf in JSTOR] *Littlefield, Daniel C. "Joh</nowiki>
|-
| [[:Baharagora]] || <nowiki>[[vi:Baharagora]</nowiki>
|-
| [[:Barbara Eden]] || <nowiki>[[Rock Hue time, in partnership with [[20th Century Fox]] studios. Eden's co-star</nowiki>
|-
| [[:Holy Transfiguration Church, Kėdainiai]] || <nowiki>[[1895] the church also turned out to be too tiny and it was replaced by the one</nowiki>
|-
| [[:Howard Apfel]] || <nowiki>[[Journal of Halacha and Contemporary Society]. He also was a Senior mentor and write</nowiki>
|-
| [[:Indy Sagu]] || <nowiki>[[Best Newcomer Award for his solo album "The Debut" presented by [[Tim Westwood]]<ref>{{cit</nowiki>
|-
| [[:Joseph Planta]] || <nowiki>[[Privy Council of the United Kingdom|Privy council in [[List of Privy Counsellor</nowiki>
|-
| [[:Mary Lou Serafine]] || <nowiki>[[http://heinonline.org/HOL/Page?handle=hein.journals/ylr100&div=83&g_sent=1&collection=journals]*Reeves</nowiki>
|-
| [[:Me Too! (UK TV series)]] || <nowiki>[[Nurse||Ross Allan|-|Rudi [[Market stall trader || [[Chris McCausland]]===Children==={|class="wikitable</nowiki>
|-
| [[:Me Too! (UK TV series)]] || <nowiki>[[Market stall trader || [[Chris McCausland]]===Children==={|class="wikitable" style="textalign-centre"|-!Character!Parent(s)|-|Lis</nowiki>
|-
| [[:Me Too! (UK TV series)]] || <nowiki>[[Physician|Doctor]Rosemary Amoani|-|-Rudi ||[[Market Stallholder| Chris McCausland|-|Micke</nowiki>
|-
| [[:One Eyed King]] || <nowiki>[[Josh Hopkins] as Chuck*[[Armand Assante]] as Holly*[[Chazz Palminteri]] as Eddi</nowiki>
|-
| [[:Pestalozzi-Stiftung Hamburg]] || <nowiki>[[strength]s and [[interest]]s, and to build social [[network]]s within the [[society]]</nowiki>
|-
| [[:Ronda Curtin]] || <nowiki>[[Western Women's Hockey League==Playing career==Prior to playing for Minnesota,</nowiki>
|}
=== Table not correct end ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2008 Asian Junior Men's Volleyball Championship]] || <nowiki> {| class="wikitable" style="text-align: center;"… </nowiki>
|-
| [[:2008 Asian Junior Women's Volleyball Championship]] || <nowiki> {| class="wikitable" style="text-align: center;"… </nowiki>
|-
| [[:2008 Asian Youth Boys Volleyball Championship]] || <nowiki> {| class="wikitable" style="text-align: center;"… </nowiki>
|-
| [[:2008 Asian Youth Girls Volleyball Championship]] || <nowiki> {| class="wikitable" style="text-align: center;"… </nowiki>
|-
| [[:2008 WNBA Finals]] || <nowiki> {| class="toccolours" style="font-size: 95%; width… </nowiki>
|-
| [[:2008–09 Southern League Cup]] || <nowiki> {| class="wikitable" style="text-align: center"|-… </nowiki>
|-
| [[:2008–09 Super 10 season]] || <nowiki> {| class="wikitable" style="float:left; margin-rig… </nowiki>
|-
| [[:2009 Big East Men's Basketball Tournament]] || <nowiki> {| class="wikitable" style="width:25em; text-align… </nowiki>
|-
| [[:2009 FIVB Boys Youth World Championship]] || <nowiki> {| class="wikitable" style="text-align: center;"… </nowiki>
|-
| [[:2009 FIVB Men's Junior World Championship]] || <nowiki> {| style=border-collapse:collapse border=1 cellspa… </nowiki>
|-
| [[:2009 Flu Pandemic Summary]] || <nowiki> {| border=".5" cellpadding="5" cellspacing="5" wid… </nowiki>
|-
| [[:2009 Inter Provincial Tournament Meyersdal]] || <nowiki> {| class="wikitable" style="font-size:90%; width: … </nowiki>
|-
| [[:2009 Japanese television dramas]] || <nowiki> {| class="wikitable"!align="left"|Japanese Title… </nowiki>
|-
| [[:2009 Super League Malaysia]] || <nowiki> {| border="2" cellpadding="2" cellspacing="0" styl… </nowiki>
|-
| [[:2009 West Java earthquake]] || <nowiki> {|class="sortable wikitable"|-!Area!Total|-| … </nowiki>
|-
| [[:2009 WNBA Finals]] || <nowiki> {| class="toccolours" style="font-size: 95%; width… </nowiki>
|-
| [[:2009–10 ACB season]] || <nowiki> {| class="wikitable sortable" style="text-align: c… </nowiki>
|-
| [[:2009–2010 Canadian network television schedule]] || <nowiki> {| class="wikitable sortable"!width="12%"|Week!w… </nowiki>
|-
| [[:2010 Sudan Premier League]] || <nowiki> {|class=infobox bordered|-|width=10px bgcolor=FF… </nowiki>
|-
| [[:24 Hour Service Station]] || <nowiki> {| border="0" cellpadding="4" cellspacing="3" widt… </nowiki>
|-
| [[:Gangland (TV series)]] || <nowiki> {| class="wikitable" width=99%|-! style="backgro… </nowiki>
|-
| [[:History of Rush]] || <nowiki> {| class="toccolours" border=1 cellpadding=2 cells… </nowiki>
|-
| [[:Jeremy Shada]] || <nowiki> {| border="2" cellpadding="4" cellspacing="0" styl… </nowiki>
|-
| [[:List of Beta Theta Pi Fraternity Alumni Associations]] || <nowiki> {| class="wikitable"|-! Location! Chapter! Yea… </nowiki>
|-
| [[:List of Sleuth 101 episodes]] || <nowiki> {| class="wikitable" width="98%"! width="5%" | Ep… </nowiki>
|}
=== Template not correct begin (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1788 in Australia]] || <nowiki>February 27 - A seventeen year {fact}}</nowiki>
|-
| [[:2006 United States immigration reform protests]] || <nowiki>Immigrant Coalition]{Dead lin|date=February 2010}}</nowiki>
|-
| [[:2008 Copa Libertadores]] || <nowiki>|publisher=conmebol.com |accessdate=2007-12-21 }}</nowiki>
|-
| [[:2008 Turkish incursion into northern Iraq]] || <nowiki>accessdate = 2008-02-28 | year = 2008 }}</ref>}}</nowiki>
|-
| [[:2009 Copa Pachuca]] || <nowiki>- [[Estadio Hidalgo]] - | ((Bandera | MEX }}</nowiki>
|-
| [[:2009 flu pandemic in Uruguay]] || <nowiki>/nacional/gripe-a-hay-otros-4-casos-y-llegan-a-21}}</nowiki>
|-
| [[:2009 in spaceflight]] || <nowiki>= [[Remote sensing]] |outcome = Operational }}}}</nowiki>
|-
| [[:2009 Inter Provincial Tournament Meyersdal]] || <nowiki><br />|831 <br />|7 <br />|7 <br />|-}}</nowiki>
|-
| [[:2009 Inter Provincial Tournament Meyersdal]] || <nowiki><br />|848 <br />|2 <br />|2 <br />|-}}</nowiki>
|-
| [[:3rd (Lahore) Division]] || <nowiki>tteer/pager.html?objectid=DS405.1.I34_V17_322.gif}}</nowiki>
|-
| [[:Alternate Vacation]] || <nowiki>2010}} 2010}}</nowiki>
|-
| [[:Attention-deficit hyperactivity disorder]] || <nowiki>M. |date=2005-01-15 |accessdate=2009-05-25}}</nowiki>
|-
| [[:Hannah Montana (season 3)]] || <nowiki>are seen lying down. |LineColor = CC99CC}}</nowiki>
|-
| [[:Heavy Rain]] || <nowiki>Games - Heavy Rain|publisher=SCEE}}</ref>}}</nowiki>
|-
| [[:Indian Space Research Organisation]] || <nowiki>name=mistry94>Mistry, 94–95</ref>}}</nowiki>
|-
| [[:Jason R. Dorfman]] || <nowiki>2Mausmaan+Di+Maar%22&ei=AECBS8fUFJbONPaUpOoP&cd=1}}</nowiki>
|-
| [[:List of wineries in Ohio]] || <nowiki>{Refimprove|date=January 2009}}</nowiki>
|-
| [[:Mark Birtles Project]] || <nowiki>It a Tie" '''VUE Weekly'''Retrieved 2010-03-04}}</nowiki>
|-
| [[:Oscar Wilde]] || <nowiki>|accessdate=19th Febuary 2010}}</nowiki>
|-
| [[:Pattern matching]] || <nowiki>structure: {fib[3],{fib[2],{fib[1]},{fib[0]}}</nowiki>
|-
| [[:Pattern matching]] || <nowiki>{fib[3],{fib[2],{fib[1]},{fib[0]}},{fib[1]}}</nowiki>
|-
| [[:Pattern matching]] || <nowiki>:= Binomial[2i, i] Compile[{x, {i, _Integer}}</nowiki>
|-
| [[:Quelepa]] || <nowiki>the third tier was approximately convert|1.6|m|ft}}</nowiki>
|-
| [[:Surya Sivakumar]] || <nowiki>1998 |work= Dinakaran |accessdate=1998-04-12}} }}</nowiki>
|-
| [[:Western Bulldogs]] || <nowiki>s/NewsArticle/tabid/208/Default.aspx?newsId=32977}}</nowiki>
|}
=== Template not correct end (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2001 El Salvador earthquakes]] || <nowiki>{{Cquote|The construction equipment of the Ministry of Public Works was thinly stretched</nowiki>
|-
| [[:2004 Atlanta Falcons season]] || <nowiki>{{ http://espn.go.com/nfl/recap?gameId=241031007]]</ref> ==Week 10==In week 10,</nowiki>
|-
| [[:2007 CIS Men's Soccer Championship]] || <nowiki>{{football squad player | no=21 | nat=CAN | pos=FW | name=[[Kofi Ilboudo]] | other=Carleton</nowiki>
|-
| [[:2008 Adelaide Football Club season]] || <nowiki>{{AFL 2008)){{Adelaide Crows}}[[Category:Adelaide Football Club seasons]][[Category:2008</nowiki>
|-
| [[:2008 Copa Simón Bolívar]] || <nowiki>{{Navbox</noinclude><includeonly>|-| {{Navbox|child</includeonly>| name = Copa</nowiki>
|-
| [[:2009 California wildfires]] || <nowiki>{{cite_news |last=Knoll |first=Corinna |coauthors=& Becerra, Hector. |title=TV, cellphone</nowiki>
|-
| [[:2009 Copa Simón Bolívar]] || <nowiki>{{Navbox</noinclude><includeonly>|-| {{Navbox|child</includeonly>| name = Copa</nowiki>
|-
| [[:2009 Milk Cup]] || <nowiki>{{footballbox|date = 27 July 2009|time = 19:00|team1 = {{fbu-rt|19|NIR}}|score =</nowiki>
|-
| [[:2009–10 UAE Premier League]] || <nowiki>{{fb|UAE} || {{flagicon|UAE}} [[Bani Yas Club|Bani Yas]]|-| || {{fb|UAE}} || {{flagicon|UAE}}</nowiki>
|-
| [[:2010 Alpine Skiing World Cup]] || <nowiki>{{flagicon===Team event==={| bgcolor="#f7f8ff" cellpadding="3" cellspacing="0" border="1"</nowiki>
|-
| [[:2010 in film]] || <nowiki>{{cite web | http://www.moviefone.com/movie/paul/38049/main</ref>|}==Notable deaths==</nowiki>
|-
| [[:2011 NHL Entry Draft]] || <nowiki>{{cite web|url=http://www.tsn.ca/nhl/story/?id=309829|title=PANTHERS TRADE DOMINIC</nowiki>
|-
| [[:23809 Haswell]] || <nowiki>{{DEFAULTSORT:{{Minor planets navigator|23808 Joshuahammer|(23810) 1998 QO45|}}{{Small</nowiki>
|-
| [[:Ainsworth Mill, Breightmet]] || <nowiki>{{DEFAULTSORT:Ainsworth Mill, Breightmet[[Category:Textile mills owned by the Lancashire</nowiki>
|-
| [[:Australian Open]] || <nowiki>{{cite web|url=http://www.atpworldtour.com/News/Tennis/2010/01/4th-Week/Australian-Open-Sunday2-Federer-Takes-Fourth-Australian-Open-Title.aspx</ref>*[[2009</nowiki>
|-
| [[:Bartholomew the Apostle]] || <nowiki>{{Saints portal} }{{Commons category|Saint Bartholomew|Bartholomew the Apostle}}*</nowiki>
|-
| [[:Halmidi inscription]] || <nowiki>{{{{Harvnb|Ramesh|1984b|pp=55–58}}</ref> 470 A.D.,<ref>{{Harvnb|Master|1944|pp=297-307}}</ref></nowiki>
|-
| [[:Kalafina discography]] || <nowiki>{{nihongo|''[[Re/oblivious]]''| align="center"|37| align="center"|6| align="center"|<ref>{{cite</nowiki>
|-
| [[:Kalafina discography]] || <nowiki>{{nihongo|''[[Seventh Heaven (Kalafina album)|Seventh Heaven]]''| align="center"|8|</nowiki>
|-
| [[:Kelly Beckett]] || <nowiki>{{citeweb|url=http://www.imdb.com/name/nm2259612/|title=Kelly Beckett|publisher=IMDb.com</ref></nowiki>
|-
| [[:Kelly Beckett]] || <nowiki>{{citeweb|url=http://www.paradisogirls.com</ref><ref> [[Paradiso Girls]] ([http://en.wikipedia.org/wiki/Paradiso_Girls])</ref>==References=={{Reflist}</nowiki>
|-
| [[:Papua New Guinea]] || <nowiki>{{cite web|url=http://hdrstats.undp.org/en/countries/data_sheets/cty_ds_PNG.html</nowiki>
|-
| [[:Pro Duta Football Club Indonesia]] || <nowiki>{{Sistem LI|level=2|promotion=[[Liga Super Indonesia]]|relegation={{Sepak bola di</nowiki>
|-
| [[:Trinity]] || <nowiki>{{Letellier, Robert. ''Day in Mamre, night in Sodom: Abraham and Lot in Genesis 18</nowiki>
|-
| [[:Wipeout (roller coaster)]] || <nowiki>{{Infobox roller coasterWipeout is a [[Vekoma]] boomerang coaster at [[Pleasurewood</nowiki>
|}
=== Template parameter with problem ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2009 Pittsburgh Pirates season]] || <nowiki>cite news, AP]] |title</nowiki>
|-
| [[:2Be3]] || <nowiki>Infobox Musical artist, center]]| Img_capt</nowiki>
|-
| [[:August Derleth]] || <nowiki>columns-list, ''Sac Prairie Saga''*''Still is the Summer Night'' (1937)*''Wind Over Wisconsin'' (1938)*''Any Day Now'' (1938)*''Restless is the River'' (1939)*''Evening in Spring'' (1941)*''Sweet Genevieve'' (1942)*''Shadow of Night'' (1943)*''The Shield of the Valiant'' (1945)*''The House of Moonlight'' (1953)'''Other'''*''Murder Stalks the Wakely Family'' (1934)*''The Man on All Fours'' (1934)*''Three Who Died'' (1935)*''Sign of Fear'' (1935)*''Sentence Deferred'' (1939)*''The Narracong Riddle'' (1940)*''Bright Journey'' (1940)*''The Seven Who Waited'' (1943)*''Mischief in the Lane'' (1944)*''No Future for Luana'' (1945)*''Oliver, The Wayward Owl'' (1945)*''The Country of the Hawk'' (1952)*''The Captive Island'' (1952)*''Fell Purpose'' (1953)*''Death by Design'' (1953)*''Empire of Fur'' (1953)*''Land of Gray Gold'' (1954)*''Land of Sky Blue Waters'' (1955)*''The House on the Mound'' (1958)*''The Moon Tenders'' (1958)*''Wilbur, The Trusting Whippoorwill'' (1959)*''The Mill Creek Irregulars'' (1959)*''The Hills Stand Watch'' (1960)*''The Pinkertons Ride Again'' (1960)*''The Ghost of Black Hawk Island'' (1961)*''Sweet Land of Michigan'' (1962)*''The Tent Show Summer'' (1963)*''The Beast in Holger's Woods'' (1968)*''The Prince Goes West'' (1968)</nowiki>
|-
| [[:Dawn Mill, Shaw]] || <nowiki>Infobox Mill building, P.S. Stott]]| 1901 || 2006 | caption</nowiki>
|-
| [[:Denis Leary]] || <nowiki>Infobox Comedian, U.S.]]| medium</nowiki>
|-
| [[:Dublin GAA]] || <nowiki>GAA squad player, John Cooke]]|club</nowiki>
|-
| [[:Gotta Get It (song)]] || <nowiki>Infobox Single, T. Gray]]| Producer</nowiki>
|-
| [[:Hands On You]] || <nowiki>Infobox Single, M. Cooper]]| Producer</nowiki>
|-
| [[:Howcast]] || <nowiki>Infobox Dotcom company, Howcast logo]]| company_type</nowiki>
|-
| [[:James "Sawyer" Ford]] || <nowiki>Infobox Lost character, *Total Centric Episodes: 6. Name</nowiki>
|-
| [[:Jesse Jane]] || <nowiki>Female adult bio, Hazel]]| hair color</nowiki>
|-
| [[:Malayalam language]] || <nowiki>Infobox Language, A bilingual Malayalam and English sign board]] |map</nowiki>
|-
| [[:Mile Jedinak]] || <nowiki>Infobox Football biography 2, ]]| clubnumber</nowiki>
|-
| [[:Nakheel Properties]] || <nowiki>Infobox Company, 100px]] || vector_logo</nowiki>
|-
| [[:Page Hamilton]] || <nowiki>Infobox musical artist, Heavy metal]]| Occupation</nowiki>
|-
| [[:Prince (musician)]] || <nowiki>Infobox musical artist, Universal]]|Associated_acts</nowiki>
|-
| [[:R&J Stone]] || <nowiki>Infobox musical artist, USA]]| Instrument</nowiki>
|-
| [[:Rahul Sankrityayan]] || <nowiki>quotation, '''Novels'''*''Baisvin Sadi'' - 1923*''Jine ke Liye'' - 1940*''Simha Senapathi'' - 1944*''Jai Yaudheya'' - 1944*''Bhago Nahin, Duniya ko Badlo'' - 1944*''Madhur Svapna'' - 1949*''Rajasthani Ranivas'' - 1953*''Vismrit Yatri'' - 1954*''Divodas'' - 1960*''Vismriti Ke Garbh Me'''''Short Stories'''*''Satmi ke Bachche'' - 1935*''Volga Se Ganga'' - 1944*''Bahurangi Madhupuri'' - 1953*''Kanaila ki Katha'' - 1955-56'''Autobiography'''*''Meri Jivan Yatra I'' - 1944*''Meri Jivan Yatra II'' - 1950*''Meri Jivan Yatra III, IV, V'' - published posthumously'''Biography'''*''Sardar Prithvi Singh'' - 1955*''Naye Bharat ke Naye Neta (2 volumes)'' - 1942*''Bachpan ki Smritiyan'' - 1953*''Atit se Vartaman (Vol I)'' - 1953*''Stalin'' - 1954*''Lenin'' - 1954*''Karl Marx'' - 1954*''Mao-Tse-Tung'' - 1954*''Ghumakkar Swami'' - 1956*''Mere Asahayog ke Sathi'' - 1956*''Jinka Main Kritajna'' - 1956*''Vir Chandrasingh Garhwali'' - 1956*''Simhala Ghumakkar Jaivardhan'' - 1960*''Kaptan Lal'' - 1961*''Simhal ke Vir Purush'' - 1961*''Mahamanav Budha'' - 1956'''Some of his other books are''':-*''Mansik Gulami''*''Rhigvedic Arya''*''Ghumakkar Shastra''*''Kinnar desh mein''*''Darshan Digdarshan''*''Dakkhini Hindi ka Vyaakaran'' *''Puratatv Nibandhawali''*''Manava Samaj''</nowiki>
|-
| [[:Rolls-Royce Merlin]] || <nowiki>#tag:ref, Factory production numbers:* Rolls-Royce: Derby</nowiki>
|-
| [[:Shawn Lalonde]] || <nowiki>Infobox Ice Hockey Player, OHL]]| team</nowiki>
|-
| [[:Shibu Soren]] || <nowiki>Infobox Indian politician, Dumka]]| salary</nowiki>
|-
| [[:Slovaks]] || <nowiki>Infobox Ethnic group, Slovak]]|rels</nowiki>
|-
| [[:Steven Tyler]] || <nowiki>Infobox musical artist, US]]| Died</nowiki>
|-
| [[:Trent Mill, Shaw]] || <nowiki>Infobox Mill building, Spinning (ring mill)]]| architectural_style</nowiki>
|-
| [[:Union Buildings]] || <nowiki>Infobox Historic building, thumb]]|caption</nowiki>
|}
=== Template programming element ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2008 Isle of Man TT]] || <nowiki>{{{Image|}}} </nowiki>
|-
| [[:2008 PBA Fiesta Conference]] || <nowiki>{{{height_ft|6}}}|in={{{height_in|1}}}|precision=2|abbr=yes}} </nowiki>
|-
| [[:2008 Phalguna Mela in Khatushyamji]] || <nowiki>{{{image|}}}| </nowiki>
|-
| [[:2008 Premier League Darts]] || <nowiki>{{{sort|}}}|wikitable sortable|wikitable}}" style="text-align: </nowiki>
|-
| [[:2008 Super 14 Final]] || <nowiki>#if:|No. 8|{{#if:|Number eight|number eight}}}}]] [[Mose </nowiki>
|-
| [[:2008–09 in Venezuelan football]] || <nowiki>{{{sort|}}}|wikitable sortable|wikitable}}" style="text-align: </nowiki>
|-
| [[:2008–09 Segunda División]] || <nowiki>{{{width|400}}}|float={{{float|right}}}}} </nowiki>
|-
| [[:2009 Úrvalsdeild]] || <nowiki>{{{width|-1}}}|text=[[Knattspyrnufélag Reykjavíkur|<span </nowiki>
|-
| [[:2009 Baylor Bears football team]] || <nowiki>{{{!}} class="navbox </nowiki>
|-
| [[:2009 Isle of Man TT]] || <nowiki>{{{Image|}}} </nowiki>
|-
| [[:2009 Kazakhstan Premier League]] || <nowiki>{{{width|500}}}|}} </nowiki>
|-
| [[:2009 Michigan Wolverines football team]] || <nowiki>{{NAMESPACE}}|{{ns:10}} </nowiki>
|-
| [[:2009–10 Segunda División]] || <nowiki>{{{width|400}}}|float={{{float|right}}}}} </nowiki>
|-
| [[:2009–10 Tunisian Ligue Professionnelle 1]] || <nowiki>{{{hth|}}}|Head-to-Head: used when two or more teams </nowiki>
|-
| [[:2010 Úrvalsdeild]] || <nowiki>{{{width|-1}}}|text=[[Knattspyrnufélag Reykjavíkur|<span </nowiki>
|-
| [[:2010 Liga Panameña de Fútbol Clausura]] || <nowiki>{{{width|400}}}|float={{{float|right}}}}} </nowiki>
|-
| [[:2010 Michigan Wolverines football team]] || <nowiki>{{NAMESPACE}}|{{ns:10}} </nowiki>
|-
| [[:2010 Widnes Vikings season]] || <nowiki>{{{size|100%}}}; background-color: {{#if:{{{bg|}}}|#{{{bg}}}|transparent}}; </nowiki>
|-
| [[:3-way junction]] || <nowiki>{{{1|Wye (railroad)}}}]].}} </nowiki>
|-
| [[:30 Odd Foot of Grunts]] || <nowiki>{{{2|30 Odd Foot of Grunts}}}] at [[Last.fm]] </nowiki>
|-
| [[:35th G8 summit]] || <nowiki>{{{titlestyle|}}} </nowiki>
|-
| [[:5 O'Clock Charlie]] || <nowiki>{{{Caption}}} </nowiki>
|-
| [[:Albert Kligman]] || <nowiki>#if:Kligman, Albert M.| </nowiki>
|-
| [[:England]] || <nowiki>{{{width|230}}}|float={{{float|right}}}}} </nowiki>
|-
| [[:So You Think You Can Dance (Poland) (season 3)]] || <nowiki>{{{1|}}}" </nowiki>
|}
=== Template with Unicode control characters (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:82nd Academy Awards]] || <nowiki>|caption= |date= Sunday, March 7, 2010|site= [[Kodak Theatre]]</br>[[Hollywood,</nowiki>
|-
| [[:Abolfazl Attar]] || <nowiki> | imagesize = 170px| caption = | birthname = | birthdate = {{birth date|1968</nowiki>
|-
| [[:Callum Stone]] || <nowiki>|250px]]| caption =Sam Callis as Sgt. Stone| first = ''Good Cop, Bad</nowiki>
|-
| [[:E. Grey Lewis]] || <nowiki>}}</nowiki>
|-
| [[:Evan Lysacek]] || <nowiki>February 1, 2010 | accessdate = February 7, 2010}}</nowiki>
|-
| [[:F. Trowbridge vom Baur]] || <nowiki>}}</nowiki>
|-
| [[:Ggtrader.com]] || <nowiki> |225px| caption = | birth_date = {{birth date and age|mf=yes|1961|03|07}}|</nowiki>
|-
| [[:Hart T. Mankin]] || <nowiki>}}</nowiki>
|-
| [[:It All Falls Apart]] || <nowiki>Thesight below 2ndalbum.jpg| Released = April 6, 2010| Recorded = | Genre</nowiki>
|-
| [[:Leonardo Facco]] || <nowiki>|180px | caption = | birth_date = {{birth date and age|mf=yes|1964|04|03}}|</nowiki>
|-
| [[:Libertarian Movement (Italy)]] || <nowiki>|200px]]|colorcode = gold|colors = [[Yellow]] or [[Gold (color)|gold]]|leader</nowiki>
|-
| [[:Little Ann Little]] || <nowiki>| imagesize = 300px| caption = | birthname = | birthdate </nowiki>
|-
| [[:Monte Pittman]] || <nowiki>| Background = non_vocal_instrumentalist| Birth_name = Monte</nowiki>
|-
| [[:Murray High School (Kentucky)]] || <nowiki>]]| imagesize =| logo =| caption =The Front of MHS| streetaddress = 501 Doran</nowiki>
|-
| [[:Rashid moussa]] || <nowiki> | Name = Rashid Moussa| Img_capt = King of Mardelli</nowiki>
|-
| [[:Roman Empire]] || <nowiki>|event_start = [[Augustus|Octavian]] proclaimed [[Augustus (honorific)|Augustus]]|year_start</nowiki>
|-
| [[:STDU Explorer]] || <nowiki>|50px|STDU Viewer Icon]]| screenshot = | caption =</nowiki>
|-
| [[:SuperValu (United States)]] || <nowiki>|U.S. Environmental Protection Agency]] |date=2009-08-25 |accessdate=2009-09-09}</nowiki>
|-
| [[:Sweethead (album)]] || <nowiki> | Released = November 2, 2009| Recorded = Recorded at Casa de Leones Studios,</nowiki>
|-
| [[:TeenNick (UK & Ireland)]] || <nowiki>|175px]]| caption = ''TEENick'' Logo| premiered = July 20, 2009| discontinued</nowiki>
|-
| [[:The Joneses]] || <nowiki> | caption = Theatrical release poster| director = [[Derrick Borte]]|</nowiki>
|-
| [[:TRT Belgesel]] || <nowiki>| launch = Unknown| owner = [[Turkish Radio and Television</nowiki>
|-
| [[:Undefined Statements]] || <nowiki>|200px|alt=Vicky Shell Photo Shoot]]| Img_capt = | Background = solo_singer|</nowiki>
|-
| [[:Zoran levnaic]] || <nowiki> ]]| fullname = Zoran Levnaic| height = {{height|m=1.80}}| nationality = Serbian,</nowiki>
|-
| [[:Zoran Levnaić]] || <nowiki> ]]| fullname = Zoran Levnaic| height = {{height|m=1.80}}| nationality = Serbian,</nowiki>
|}
== Middle Priority ==
=== Headline double ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:A History of the World in 100 Objects]] || <nowiki>===Week's title to be announced===</nowiki>
|-
| [[:Honda D engine]] || <nowiki>====D15B====</nowiki>
|-
| [[:List of Dhangar clans in India]] || <nowiki>==Yadav== </nowiki>
|-
| [[:List of discontinued Volkswagen Group petrol engines]] || <nowiki>===1.4 44kW===</nowiki>
|-
| [[:The Sun Always Shines on T.V.]] || <nowiki>=== 12": Warner Bros. / W 8846T {{flagicon|UK}} ===</nowiki>
|-
| [[:Triberg chess tournament]] || <nowiki>==Triberg 1915==</nowiki>
|}
=== DEFAULTSORT with special characters (AWB, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:John "Jack" Spoor Broome]] || <nowiki>""</nowiki> || <nowiki>DEFAULTSORT:Broome,John "Jack" Spoor</nowiki>
|-
| [[:Observatoire National de la Pauvreté et de l'Exclusion Sociale]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Observatoire National de la Pauvreté et de l'Exclusion Sociale</nowiki>
|}
=== External link with line break ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2009 in chess]] || <nowiki>[http://www.fide.com/component/content/article/1-fide-news/3667-january-2009-fide-rating-list </nowiki>
|-
| [[:2009 in Sri Lanka]] || <nowiki>[http://news.bbc.co.uk/2/hi/south_asia/7901321.stm</ref>* 3 March - Gunmen [[2009 </nowiki>
|-
| [[:2009 Sudan Premier League]] || <nowiki>[http://www.goalzz.com/main.aspx?c=4299&stage=1Goalzz.com] </nowiki>
|-
| [[:2009 Sydney Telstra 500]] || <nowiki>[http://www.natsoft.com.au/cgi-bin/results.cgi?06/12/2009.SOP Official timing and </nowiki>
|-
| [[:2009 Tamil diaspora protests]] || <nowiki>[http://www.lankanewspapers.com/news/2009/2/39361_space.html MURUGATHASAN IMMOLATED </nowiki>
|-
| [[:2009 Toulouse Olympique season]] || <nowiki>[http://www.com1site.com/upload/Dossier%20de%20presse.pdf French federation press </nowiki>
|-
| [[:2010 Melbourne live music rally]] || <nowiki>[http://www.take40.com/news/18432/melbourne-slam-rally-draws-punters-and-musicians-in-protest-of-new-liquor-license-laws </nowiki>
|-
| [[:2010 Sudan Premier League]] || <nowiki>[http://www.goalzz.com/main.aspx?c=5711&stage=1Goalzz.com] </nowiki>
|-
| [[:24 Preludes and Fugues (Shostakovich)]] || <nowiki>[http://www.kleep.com/Music/Preludio-Y-Fuga-Para-Piano-En-D-dimitri-Shostakovich-Marco-A-Gil---Piano.894301[[Category:Compositions </nowiki>
|-
| [[:261st Theater Tactical Signal Brigade]] || <nowiki>[http://www.delawarenationalguard.com/ Delaware National Guard* [http://www.globalsecurity.org/military/agency/army/261sig-bde.htm </nowiki>
|-
| [[:3,3’,5,5’-Tetramethylbenzidine]] || <nowiki>[http://www.sigmaaldrich.com/catalog/search/ProductDetail/ALDRICH/860336 Sigma Aldrich </nowiki>
|-
| [[:4-Aminopyridine]] || <nowiki>[http://www.acorda.com/pipeline_fampridine_sci1.asp] </nowiki>
|-
| [[:A Social State]] || <nowiki>[http://www.myspace.com/asocialstate/ A Social State MySpace)* [http://www.facebook.com/pages/A-Social-State/293741482146?ref=ts/ </nowiki>
|-
| [[:Colorado Coal and Iron Company]] || <nowiki>[http://ghostdepot.com/rg/mainline/royal%20gorge%20route/pueblo.htm Pueblo, CO, retrieved </nowiki>
|-
| [[:Delhi School of Management]] || <nowiki>[http://newfrontiersinbiofuels.org 1st International Conference on New frontiers </nowiki>
|-
| [[:History of Google Docs]] || <nowiki>[http://toolbar.netcraft.com/sitProxy-Connection: keep-aliveCache-Control: max-age=0report?url=http://www.writely.com </nowiki>
|-
| [[:List of Puerto Ricans]] || <nowiki>[http://www.ctio.noao.edu/diroff/ctio_history.htm Brief History of THE CERRO TOLOLO </nowiki>
|-
| [[:Morten ring christensen]] || <nowiki>[http://www.vg.no/sport/ski/artikkel.php?artid=586602 Newspaper article)*[ http://www.facebook.com/search/?ref=search&q=morten%20r%20christensen&init=quick </nowiki>
|-
| [[:Murder (Canadian law)]] || <nowiki>[http://everything2.com/e2node/Criminal%2520Code%2520of%2520Canada%2520-%2520Part%2520XXIII.3%2520Sentencing%2520continued </nowiki>
|-
| [[:Soil contamination]] || <nowiki>[http://www.newscientisttech.com_healtheffects-pollution{{DEFAULTSORT:Soil Contamination}}[[Category:Soil </nowiki>
|-
| [[:Sustainable Lighting]] || <nowiki>[http://www.vistalight.net [[Category:Articles created via </nowiki>
|-
| [[:The Sound Manifesto]] || <nowiki>[http://www.frameworkonline.com/42cb.htm Call for a new role of ''Director of Sound'' </nowiki>
|-
| [[:Vladimir Guerrero]] || <nowiki>[http://texas.rangers.mlb.com/news/article.jsp?ymd=20100111&content_id=7898670&vkey=news_tex&fext=.jsp&c_id=tex </nowiki>
|-
| [[:Vonnegut & Bohn]] || <nowiki>[http://www.indianahistory.org/library/manuscripts/collection_guides/P0160.html#SKETCH </nowiki>
|-
| [[:World Vision Australia]] || <nowiki>[http://trans.worldvision.com.au/news/newsonline/viewArticle_enh.asp?articleID=433 </nowiki>
|}
=== Headline hierarchy (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010 Australian football code crowds]] || <nowiki>==Attendances by Match==</nowiki><br /><nowiki>=====Single Matches=====</nowiki>
|-
| [[:2010 Australian football code crowds]] || <nowiki>==Included Competitions==</nowiki><br /><nowiki>=====National Competitions=====</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Writing===</nowiki><br /><nowiki>=====Outstanding Writing in a Comedy Series=====</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Directing===</nowiki><br /><nowiki>=====Outstanding Directing for a Comedy Series=====</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Motion Picture===</nowiki><br /><nowiki>=====Outstanding Motion Picture=====</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Recording===</nowiki><br /><nowiki>=====Outstanding New Artist=====</nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>===Television===</nowiki><br /><nowiki>=====Outstanding Comedy Series=====</nowiki>
|-
| [[:5-1-1]] || <nowiki>==Active 511 Systems==</nowiki><br /><nowiki>====Tennessee====</nowiki>
|-
| [[:Alphonso Ford]] || <nowiki>==Pro career==</nowiki><br /><nowiki>====NBA and CBA====</nowiki>
|-
| [[:Choque-Rei]] || <nowiki>== Staffs ==</nowiki><br /><nowiki>====Current squad-Palmeiras====</nowiki>
|-
| [[:Guitar Song]] || <nowiki>==Track listing==</nowiki><br /><nowiki>====CD single (568 910-2)====</nowiki>
|-
| [[:Kiddush]] || <nowiki>==Holiday eve kiddush==</nowiki><br /><nowiki>====English translation of holiday eve kiddush====</nowiki>
|-
| [[:Kiddush]] || <nowiki>==Holiday morning kiddush==</nowiki><br /><nowiki>====English translation of holiday morning kiddush====</nowiki>
|-
| [[:Kiddush]] || <nowiki>== Hebrew text of Friday night kiddush ==</nowiki><br /><nowiki>====English translation of Friday night kiddush====</nowiki>
|-
| [[:Kiddush]] || <nowiki>==Shabbat morning kiddush==</nowiki><br /><nowiki>====English translation of Shabbat morning kiddush====</nowiki>
|-
| [[:Latvia national under-19 football team]] || <nowiki>==Current players==</nowiki><br /><nowiki>====Goalkeepers====</nowiki>
|-
| [[:Legal status of the Universal Life Church]] || <nowiki>==Court cases in the United States==</nowiki><br /><nowiki>====Federal====</nowiki>
|-
| [[:List of rulers of Hungary]] || <nowiki>== Kings of Hungary==</nowiki><br /><nowiki>==== House of Árpad====</nowiki>
|-
| [[:List of rulers of Hungary]] || <nowiki>==Leaders of Hungary== </nowiki><br /><nowiki>==== House of Árpad ====</nowiki>
|-
| [[:List of rulers of Hungary]] || <nowiki>==Grand princes of Hungary== </nowiki><br /><nowiki>==== House of Árpad ====</nowiki>
|-
| [[:Marco Moré]] || <nowiki>== Discography ==</nowiki><br /><nowiki>==== Studio Albums ====</nowiki>
|-
| [[:Murder (Canadian law)]] || <nowiki>==Causation==</nowiki><br /><nowiki>====Penalties====</nowiki>
|-
| [[:North Shore (Sydney)]] || <nowiki>==Geography==</nowiki><br /><nowiki>====Upper North Shore====</nowiki>
|-
| [[:North Shore (Sydney)]] || <nowiki>==List of suburbs==</nowiki><br /><nowiki>=====Upper North Shore=====</nowiki>
|-
| [[:Who Wants to Be a Millionaire (US game show)]] || <nowiki>==Syndication==</nowiki><br /><nowiki>====List of Fill-In Hosts====</nowiki>
|}
=== HTML table element (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2009 flu pandemic in Uruguay]] || <nowiki><tr> </nowiki>
|-
| [[:2009 flu pandemic in Venezuela]] || <nowiki><tr> </nowiki>
|-
| [[:2009 Memorial Cup]] || <nowiki><table><tr><td valign=top> </nowiki>
|-
| [[:2009 MLS Expansion Draft]] || <nowiki>|below = <tr> </nowiki>
|-
| [[:2009 Price Chopper 400]] || <nowiki><TABLE><TR><TD> </nowiki>
|-
| [[:2009 Sylvania 300]] || <nowiki></TD><TD> </nowiki>
|-
| [[:2010 Allan Cup]] || <nowiki><table><tr><td valign=top width=30%> </nowiki>
|-
| [[:2010 Iowa State Cyclones football team]] || <nowiki><table class="wikitable"> <tr> <td valign=top> <table> </nowiki>
|-
| [[:234 (number)]] || <nowiki><table border=1 style="float: right; border-collapse: collapse;"> </nowiki>
|-
| [[:23d Wing]] || <nowiki><table align=center class="wikitable"> </nowiki>
|-
| [[:25th Legislative Assembly of Saskatchewan]] || <nowiki><table> </nowiki>
|-
| [[:26th Alberta Legislative Assembly]] || <nowiki><table> </nowiki>
|-
| [[:2nd arrondissement of Paris]] || <nowiki><th>Year<br>(of French censuses) </nowiki>
|-
| [[:2nd Rifle Division (Soviet Union)]] || <nowiki><table border=0 width=250 cellpadding=2 cellspacing=0 align=right> </nowiki>
|-
| [[:3-2-1 Contact]] || <nowiki><tr> </nowiki>
|-
| [[:354th Fighter Wing]] || <nowiki><table align=center class="wikitable"> </nowiki>
|-
| [[:38th Parliament of British Columbia]] || <nowiki><table> </nowiki>
|-
| [[:39th Parliament of British Columbia]] || <nowiki><table> </nowiki>
|-
| [[:3rd arrondissement of Paris]] || <nowiki><th>Year<br>(of French censuses) </nowiki>
|-
| [[:43 (number)]] || <nowiki><table align=center width=120px;> </nowiki>
|-
| [[:49th Armored Division (United States)]] || <nowiki><table border=0> </nowiki>
|-
| [[:4th arrondissement of Paris]] || <nowiki><th>Year<br>(of French censuses) </nowiki>
|-
| [[:Kate L Lester]] || <nowiki><table border=1 width=250 cellpadding=2 cellspacing=0 align=right> </nowiki>
|-
| [[:PayDay (lottery)]] || <nowiki><table border="1" cellpadding="5" cellspacing="0"> </nowiki>
|-
| [[:Yeywa Dam]] || <nowiki>| extra =<center>'''Other information'''</center></tr><th>Designer</th><td>Colenco </nowiki>
|}
=== HTML text style element <nowiki><small></nowiki> in ref, sub or sup ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1984 African Cup Winners' Cup]] || <nowiki>Sports]]'''|CTA|——<sup><small>1</small></sup>|'''[[GD Lage]]'''|EQG|0-0|abd}}{{TwoLegResult|'''[[Might </nowiki>
|-
| [[:1985 African Cup Winners' Cup]] || <nowiki>Star]]'''|Burundi|3-3<sup><small>1</small></sup>|'''[[Waxool]]'''|Somalia|3-1|0-2}}{{TwoLegResult|'''[[AS </nowiki>
|-
| [[:2002 World University Baseball Championship]] || <nowiki>Baseball Champions|CUB|1<sup><small>st</small></sup>}}{{col-end}}==References=={{reflist}}==Externa </nowiki>
|-
| [[:2003 Tampa Bay Buccaneers season]] || <nowiki>2003-10-17 | accessdate = 2007-10-05}}</small></ref>The Colts scored </nowiki>
|-
| [[:2004 Palm Island death in custody]] || <nowiki>2006.<small> Accessed 3 September 2009</small></ref> Chris Hurley arrested </nowiki>
|-
| [[:2004–05 Sri Lankan cricket season]] || <nowiki>disaster]] on 26 December 2004.</small></ref>* Most runs – </nowiki>
|-
| [[:2006 WNBA All-Star Game]] || <nowiki> {{Col-end}}*<sup><small>1</small></sup> Injured*<sup><small>2</small></sup </nowiki>
|-
| [[:2007 Colorado Buffaloes football team]] || <nowiki><sup><small>2006</small></sup>| scout stars = </nowiki>
|-
| [[:2007 Tampa Bay Buccaneers season]] || <nowiki>2007-12-17 | accessdate = 2007-12-17}}</small></ref><ref name="Kickoff-return </nowiki>
|-
| [[:2007 WNBA All-Star Game]] || <nowiki> {{Col-end}}*<sup><small>1</small></sup> Injured*<sup><small>2</small></sup </nowiki>
|-
| [[:2007–08 Football Conference]] || <nowiki>2007. <small>Retrieved 30 October 2007.</small></ref><br><sup>2</sup> </nowiki>
|-
| [[:2008 Chinese milk scandal]] || <nowiki>23 September 2008''</small></ref> After the initial </nowiki>
|-
| [[:2008 in Norway]] || <nowiki>Retrieved on February 1, 2008</small></ref>*28 January – </nowiki>
|-
| [[:2008 Summer Olympics closing ceremony]] || <nowiki>(Retrieved on August 24, 2008)</small></ref> It was directed </nowiki>
|-
| [[:2008 World Mixed Doubles Curling Championship]] || <nowiki>(Retrieved on March 22, 2008)</small></ref> It was the first </nowiki>
|-
| [[:2008 World University Baseball Championship]] || <nowiki>Baseball Champions|USA|3<sup><small>rd</small></sup>}}{{col-end}}==References=={{reflist}}==Externa </nowiki>
|-
| [[:2009 Baseball World Cup]] || <nowiki>World Cup Champions|USA|4<sup><small>th</small></sup>}}{{col-end}}==Awards==The </nowiki>
|-
| [[:2009 New York Liberty season]] || <nowiki>standings|team=NYL}}<sup><small>x</small></sup> =Clinched Playoff </nowiki>
|-
| [[:2009 Wimbledon Championships]] || <nowiki>of 14 grand slams with 15<sup><small>th</small></sup> slam title.]][[Image:SerenaStretchWimbledon.jpg|thumb|right|150px|[[Seren </nowiki>
|-
| [[:2009–10 Libyan Premier League]] || <nowiki> {{fb r |gf=0 |ga=2 }}<sup><small>2</small></sup> </nowiki>
|-
| [[:34th G8 summit]] || <nowiki><sup><small>Statment</small></sup>], [[Iran]] and [[North </nowiki>
|-
| [[:4:AM]] || <nowiki>2004 Issue 251 <small>by Simon Bradley</small></ref>==Track listing==#"4am </nowiki>
|-
| [[:Eve Muirhead]] || <nowiki>(Retrieved on 21 March 2008)</small></ref> Muirhead was skip </nowiki>
|-
| [[:Kings and Queens (Jamie T album)]] || <nowiki>"Saint Christopher" replaced it. </small></ref>===Bonus tracks </nowiki>
|-
| [[:Rousseaceae]] || <nowiki>ISBN 9780958943673 <small>page 326</small></ref> and twelve or thirteen </nowiki>
|}
=== Link equal to linktext (AWB, AutoEd, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010 Canada anti-prorogation protests]] || <nowiki>[[non-partisan|non-partisan]] </nowiki>
|-
| [[:2010 Formula One season]] || <nowiki>[[Lotus Racing|Lotus Racing]] </nowiki>
|-
| [[:2010 in film]] || <nowiki>[[67th Golden Globe Awards|67th Golden Globe Awards]] </nowiki>
|-
| [[:2010 IRB Junior World Championship]] || <nowiki>[[Estadio Newell's Old Boys|Estadio Newell's Old Boys]] </nowiki>
|-
| [[:2010 McDonald's All-American Boys Game]] || <nowiki>[[Coral Springs, FL|Coral Springs, FL]] </nowiki>
|-
| [[:2010 NAACP Image Awards]] || <nowiki>[[The Blind Side|The Blind Side]] </nowiki>
|-
| [[:2011 in sports]] || <nowiki>[[January 29|January 29]] </nowiki>
|-
| [[:2011 Pacific Games]] || <nowiki>[[New Caledonia|New Caledonia]] </nowiki>
|-
| [[:Big 8 Conference (Missouri)]] || <nowiki>[[Monett High School|Monett High School]] </nowiki>
|-
| [[:Cail MacLean]] || <nowiki>[[ECHL|ECHL]] </nowiki>
|-
| [[:Clothing]] || <nowiki>[[religion|religion]] </nowiki>
|-
| [[:Curt Hawkins and Zack Ryder]] || <nowiki>[[Raw|Raw]] </nowiki>
|-
| [[:Gregory Weir]] || <nowiki>[[GIMP|GIMP]] </nowiki>
|-
| [[:History of the Socialist Left Party]] || <nowiki>[[Socialist People's Party|Socialist People's Party]] </nowiki>
|-
| [[:Indian Space Research Organisation]] || <nowiki>[[National Remote Sensing Centre|National Remote Sensing Centre]] </nowiki>
|-
| [[:Latvia national under-19 football team]] || <nowiki>[[Daugavpils BJSS|Daugavpils BJSS]] </nowiki>
|-
| [[:List of IIM Calcutta alumni]] || <nowiki>[[Mohanbir Sawhney|Mohanbir Sawhney]] </nowiki>
|-
| [[:Mark Mapletoft]] || <nowiki>[[Loughborough Students RUFC|Loughborough Students RUFC]] </nowiki>
|-
| [[:Pro Duta Football Club Indonesia]] || <nowiki>[[Divisi Utama Liga Indonesia 2009/2010|Divisi Utama Liga Indonesia 2009/2010]] </nowiki>
|-
| [[:Steven Cutts]] || <nowiki>[[United States|United States]] </nowiki>
|-
| [[:Tommy Green (footballer born 1913)]] || <nowiki>[[Bromyard F.C|Bromyard F.C]] </nowiki>
|-
| [[:Viva la Vida]] || <nowiki>[[Canadian Hot 100|Canadian Hot 100]] </nowiki>
|-
| [[:Vladimir Salkov]] || <nowiki>[[1988 Summer Olympics|1988 Summer Olympics]] </nowiki>
|-
| [[:Western Bulldogs]] || <nowiki>[[AAMI Stadium|AAMI Stadium]] </nowiki>
|-
| [[:Zürichhorn]] || <nowiki>[[Lindenhof hill|Lindenhof hill]] </nowiki>
|}
=== Reference list missing (partial AWB) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Antonio Anderson (American football)]] ||
|-
| [[:Vehicular homicide (Oregon)]] ||
|}
== Lowest Priority ==
=== HTML text style element <nowiki><font></nowiki> ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1000 Ways to Die]] || <nowiki>'''"<font color="red">WARNING:</font>''' The deaths portrayed in this show are real… </nowiki>
|-
| [[:2008 Tour of Britain]] || <nowiki>|style="background:red;" rowspan=3| <font color=white>[[Kristian House]]</font>… </nowiki>
|-
| [[:25th Legislative Assembly of Saskatchewan]] || <nowiki><td bgcolor=#FFFFFF border=1><font color=#FFFFFF size=-2>****</td>… </nowiki>
|-
| [[:26th Alberta Legislative Assembly]] || <nowiki><td bgcolor="cornflowerblue" border=1><font color="cornflowerblue" size=-2>****</td… </nowiki>
|-
| [[:2channel]] || <nowiki>2ch was opened on May 30, 1999 in a college apartment in [[Conway, Arkansas]], on… </nowiki>
|-
| [[:2channel Shift JIS art]] || <nowiki><font face="ＭＳ Ｐゴシック" size="3"> … </nowiki>
|-
| [[:3 (number)]] || <nowiki><font style="font-size:200%;">٣</font><ref>Georges Ifrah, ''The Universal History… </nowiki>
|-
| [[:30 (number)]] || <nowiki>| misc =[[Hebrew (language)|Hebrew]] <font style="font-size:150%;">ל</font>… </nowiki>
|-
| [[:300 (number)]] || <nowiki>{{!}} <font style="font-size:150%;">ש</font> (Shin)… </nowiki>
|-
| [[:330th Bombardment Group]] || <nowiki>* Aircraft: <font color="red">'''K-59'''</font>… </nowiki>
|-
| [[:38th Parliament of British Columbia]] || <nowiki><td bgcolor=#FF7F00 border=1><font color=#FF7F00 size=-2>****</td>… </nowiki>
|-
| [[:39th Parliament of British Columbia]] || <nowiki><td bgcolor=#FFFFFF border=1><font color=#FFFFFF size=-2>*</td>… </nowiki>
|-
| [[:3e]] || <nowiki>Movies are in '''<font color="F08080">red</font>''';comedies are in '''<font color="a4f49e">green</font>''',… </nowiki>
|-
| [[:40 (number)]] || <nowiki>| misc =[[Hebrew (language)|Hebrew]] <font style="font-size:150%;">מ</font>… </nowiki>
|-
| [[:400 (number)]] || <nowiki>| misc = [[Hebrew language|Hebrew]] <font style="font-size:150%;">ת</font> (Tav… </nowiki>
|-
| [[:40th Quebec general election]] || <nowiki>!rowspan="2"|<font style="font-size: 80%;">Candi-<br/>dates</font>… </nowiki>
|-
| [[:Caroline Springs railway station, Melbourne]] || <nowiki>| ZONE=<font color=blue>2</font>… </nowiki>
|-
| [[:FC Seoul season 2010]] || <nowiki>{{Image label|x=0.43|y=1.25|scale=350|text=<font size=2 color="Black">[[Kim Ho-Jun|'''Ho-Jun''']]</font>}… </nowiki>
|-
| [[:Indian Space Research Organisation]] || <nowiki>::''Status: <font color="Grey">Decommissioned</font color="Grey">''… </nowiki>
|-
| [[:Kazakhstan]] || <nowiki>|HDI_category=<font color="#009900">high</font>… </nowiki>
|-
| [[:List of programs broadcast by The CW]] || <nowiki>Returning dramas are in '''<font color="a4f49e">green</font>'''; new dramas are in… </nowiki>
|-
| [[:Manchester City F.C. season 2003–04]] || <nowiki><small><sup><FONT color="red">1.</FONT></sup> Middlesbrough qualified for the UEFA… </nowiki>
|-
| [[:Paris Saint-Germain F.C. season 2008–09]] || <nowiki>{{Image label|x=0.40|y=1.26|scale=350|text=<font size=2 color="Black">{{flagicon|FRA}}… </nowiki>
|-
| [[:Romania]] || <nowiki>|HDI_category = <font color="green">high</font>… </nowiki>
|-
| [[:Romanian language]] || <nowiki><font style="font-size:90%">… </nowiki>
|}
=== HTML text style element <nowiki><p></nowiki> ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:19th Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Mars-la-Tour|Mars-la-Tour]], [[Battle… </nowiki>
|-
| [[:2001 Cleveland Browns season]] || <nowiki><p>… </nowiki>
|-
| [[:2004 Bradford Bulls season]] || <nowiki><p><font size="3">Final Premiership table for the 2004 season.</font></p>… </nowiki>
|-
| [[:2004 Palm Island death in custody]] || <nowiki>In May 2009 Mulrunji's family's lawyers attempted to have Judge Pack's decision ruled… </nowiki>
|-
| [[:2007 Weber Cup]] || <nowiki><p>The Europeans were once again skippered by [[Sweden]]’s [[Tomas Leandersson]]… </nowiki>
|-
| [[:2008 Civil War game]] || <nowiki><p>… </nowiki>
|-
| [[:2009 Rally Isle of Man]] || <nowiki><p>… </nowiki>
|-
| [[:2009–10 FA Cup]] || <nowiki>Teams from Leagues [[Football League One|One]] and [[Football League Two|Two]] enter… </nowiki>
|-
| [[:2009–10 Ohio Bobcats men's basketball team]] || <nowiki>Following Ohio's exhibition win against Ashland on November 13, John Groce announced… </nowiki>
|-
| [[:2009–10 Portland Trail Blazers season]] || <nowiki><p>Signed [[Juwan Howard]] to a one year deal <ref>http://sports.espn.go.com/nba/news/story?id=4481905</ref… </nowiki>
|-
| [[:2010 San Francisco 49ers season]] || <nowiki>'''COLOR KEY AND NOTES:''':<p>{{colorbox|#ffcccc}} Red indicates the [[NFL International… </nowiki>
|-
| [[:20th Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Mars-la-Tour|Mars-la-Tour]], [[Battle… </nowiki>
|-
| [[:21st Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Wœrth (1870)|Woerth]], [[Battle of… </nowiki>
|-
| [[:22nd Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Wœrth (1870)|Woerth]], [[Battle of… </nowiki>
|-
| [[:23rd Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Gravelotte|Gravelotte]], [[Battle of… </nowiki>
|-
| [[:24th Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Gravelotte|Gravelotte]], [[Battle of… </nowiki>
|-
| [[:25th Division (German Empire)]] || <nowiki>|battles=[[Franco-Prussian War]]: [[Battle of Mars-la-Tour|Mars-la-Tour]], [[Battle… </nowiki>
|-
| [[:27th Infantry Regiment]] || <nowiki><P>1st Battalion… </nowiki>
|-
| [[:3×3 Eyes]] || <nowiki><P>… </nowiki>
|-
| [[:5 cent 1948 (Dutch coin)]] || <nowiki>Circulation = ? –<br />28 January 2002<p>Redeemed by national bank until… </nowiki>
|-
| [[:5 guilder (Dutch coin)]] || <nowiki> Circulation = 1 May 1988–<br>28 February 2002<p> Redeemed by national… </nowiki>
|-
| [[:I Gotta Feeling]] || <nowiki><p>… </nowiki>
|-
| [[:Khortanna]] || <nowiki>Khortanna<p>… </nowiki>
|-
| [[:So You Think You Can Dance Australia (season 3)]] || <nowiki>No voting this week in order to give the dancers the chance to showcase themselves… </nowiki>
|-
| [[:WWII in HD]] || <nowiki>http://www.history.com/content/wwii-in-hd/about-the-series<p>… </nowiki>
|}
=== DEFAULTSORT missing for titles with special letters (partial AWB, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:$100 Solution]] ||
|-
| [[:$5 Cover]] ||
|-
| [[:17º Stormo Incursori]] ||
|-
| [[:1° West]] ||
|-
| [[:27ème bataillon de chasseurs alpins]] ||
|-
| [[:30° Everywhere]] ||
|-
| [[:3×3 Eyes]] ||
|-
| [[:5 * Stunna]] ||
|-
| [[:Anón]] ||
|-
| [[:Сер Алекс Фергусон]] ||
|-
| [[:F**k It (I Don't Want You Back)]] ||
|-
| [[:Häädemeeste]] ||
|-
| [[:Hüsn ü Aşk]] ||
|-
| [[:Jüri]] ||
|-
| [[:Käravete]] ||
|-
| [[:Krásnohorská Cave]] ||
|-
| [[:Mōretsu Atarō]] ||
|-
| [[:Otōto (2010 film)]] ||
|-
| [[:Peñafrancia Tours and Travel Transport Inc.]] ||
|-
| [[:Phú Khê]] ||
|-
| [[:Shōnan no Kaze]] ||
|-
| [[:Shōnan no Kaze discography]] ||
|-
| [[:Tõstamaa]] ||
|-
| [[:Zürichhorn]] ||
|-
| [[:Żurrieq F.C. seasons]] ||
|}
=== Headline ALL CAPS ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:10 Gigabit Ethernet]] || <nowiki>==WAN PHY (10GBASE-W)==</nowiki>
|-
| [[:2009 flu pandemic in the Philippines by region]] || <nowiki>===[[SOCCSKSARGEN]]===</nowiki>
|-
| [[:4th Brigade Combat Team, 2nd Infantry Division (United States)]] || <nowiki>=== OPERATION RAIDER RIVIERA ===</nowiki>
|-
| [[:AIM-120 AMRAAM]] || <nowiki>====ACEVAL/AIMVAL====</nowiki>
|-
| [[:B-47 Stratojet]] || <nowiki>===RB-47E/RB-47H/ERB-47H/RB-47K===</nowiki>
|-
| [[:Delaware Lottery]] || <nowiki>==MULTI-WIN LOTTO==</nowiki>
|-
| [[:Dodge Ram]] || <nowiki>==2002–2008 (DR/DH/D1/DC/DM)==</nowiki>
|-
| [[:DWRR-FM]] || <nowiki>===DWWK/DWOK-FM (1973-1986)===</nowiki>
|-
| [[:ERDAS IMAGINE]] || <nowiki>===ERDAS IMAGINE===</nowiki>
|-
| [[:Hammond organ]] || <nowiki>====B-2 / C-2 / RT / RT-2 / E / C / D====</nowiki>
|-
| [[:HD DVD]] || <nowiki>===HD DVD-R / -RW / -RAM===</nowiki>
|-
| [[:Isolation (database systems)]] || <nowiki>===READ UNCOMMITTED===</nowiki>
|-
| [[:Kimi e...]] || <nowiki>=== CD2 - MAYU☆FUYU SELECTION ===</nowiki>
|-
| [[:KMC International Center]] || <nowiki>==FAIMER/IMED==</nowiki>
|-
| [[:Lexus LS]] || <nowiki>=== USF40 II / USF41 II (2009) ===</nowiki>
|-
| [[:Millennium Foundation]] || <nowiki>==MASSIVEGOOD==</nowiki>
|-
| [[:NASCAR 99]] || <nowiki>==NASCAR 99 LEGACY==</nowiki>
|-
| [[:P-47 Thunderbolt]] || <nowiki>===P-47D / P-47G / XP-47K / XP-47L===</nowiki>
|-
| [[:PAL]] || <nowiki>==== PAL B/G/D/K/I ====</nowiki>
|-
| [[:Rajiv Gandhi Technical University]] || <nowiki>==BEC/GEC/UIT-RGPV==</nowiki>
|-
| [[:Ramesh Nadkarni]] || <nowiki>====RAGA – BAIRAGI BHAIRAV====</nowiki>
|-
| [[:Second Armistice at Compiègne]] || <nowiki>===ARTICLE XXIV.===</nowiki>
|-
| [[:Show Luo]] || <nowiki>====SHOW YOUR DANCE====</nowiki>
|-
| [[:Thurakapalem]] || <nowiki>== MAA UURU ANNA NAAKU GARVAM ==</nowiki>
|-
| [[:Windows Registry]] || <nowiki>==== HKEY_DYN_DATA ====</nowiki>
|}
=== Headline with HTML (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Ballard High School (Louisville, Kentucky)]] || <nowiki><h2><span class="editsection"></span> <span class="mw-headline"</nowiki>
|-
| [[:Demographics of the United States]] || <nowiki><h6> </nowiki>
|-
| [[:Information sensitivity]] || <nowiki><h4>n<br />o<br />n<br />-<br />c<br />l<br />a<br</nowiki>
|-
| [[:National Bicycle League]] || <nowiki><h5> </nowiki>
|-
| [[:Tubal reversal]] || <nowiki><h3>pregnancy rates by age</h3><p>as expected, younger</nowiki>
|-
| [[:United States Bicycle Motocross Association]] || <nowiki><h5> </nowiki>
|-
| [[:University of Delhi]] || <nowiki><h3>list of chancellors</h3> </nowiki>
|-
| [[:Wairarapa Line]] || <nowiki><h4>wellington section</h4>|-! distance from wellington!</nowiki>
|}
=== HTML list elements ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1925 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1926 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1927 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1928 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1929 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1930 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1931 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1932 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1933 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1934 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1935 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1936 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1937 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:1938 Nebraska Cornhuskers football team]] || <nowiki></tr></table><ul> </nowiki>
|-
| [[:2009 Boise State Broncos football team]] || <nowiki><ol> </nowiki>
|-
| [[:2009–10 NBA season]] || <nowiki><ol> </nowiki>
|-
| [[:27th Infantry Regiment]] || <nowiki><UL><LI>1991-1993 LTC [[Danny_McKnight|Danny R. McKnight]]</LI> </nowiki>
|-
| [[:3-D (SPC ECO album)]] || <nowiki><ol> </nowiki>
|-
| [[:Bison-1]] || <nowiki><ul> </nowiki>
|-
| [[:Cousin Relationships of British Monarchs and Consorts]] || <nowiki><ol> </nowiki>
|-
| [[:European Foundation for Management Development]] || <nowiki><li>EFMD has over 30 years of experience in the coordination of projects & activities </nowiki>
|-
| [[:Fedor Emelianenko]] || <nowiki><li> 2009 Knockout of the Year by [[Sherdog]] for his knockout of Andrei Arlovski </nowiki>
|-
| [[:Gaza War]] || <nowiki>In addition to the rockets fired from Gaza, Israel experienced other attacks along </nowiki>
|-
| [[:Miguel Ángel Virasoro]] || <nowiki><ul> </nowiki>
|-
| [[:Zombieland]] || <nowiki><ol> </nowiki>
|}
=== HTML text style element <nowiki><small></nowiki> double ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1991 College Football All-America Team]] || <nowiki>Jones]], Florida State <small> <small>(AP, UPI, NEA, </nowiki>
|-
| [[:2005 Minnesota Twins season]] || <nowiki>CHAMPIONS: Elizabethton</small></small><ref>Johnson, Lloyd, </nowiki>
|-
| [[:2008–09 Montreal Canadiens season]] || <nowiki> </small></small>*Halak was replaced </nowiki>
|-
| [[:Alan Sugar]] || <nowiki>2007}}{{Infobox Person|name = <small><small>[[The Right Honourable]]</small></small><br/>Th </nowiki>
|-
| [[:Bosnia and Herzegovina]] || <nowiki>=Bosna i Hercegovina <small><small>([[bosnian language|<font </nowiki>
|-
| [[:Brand New Eyes]] || <nowiki>[[#Release history|release history]])</small></small>| Recorded </nowiki>
|-
| [[:Deus Ex]] || <nowiki><small>([[PlayStation 2|PS2]])</small> </small> <br />[[Steam </nowiki>
|-
| [[:Eckerd Open]] || <nowiki>Federal Open <small>(1977–85)</small></small><br />Eckerd Open </nowiki>
|-
| [[:French people]] || <nowiki>people - mosaic.PNG|350px]]<small><small> 1<sup>st</sup> row: </nowiki>
|-
| [[:Gujarati people]] || <nowiki> = |caption = <small><small> 1<sup>st</sup> row: </nowiki>
|-
| [[:Ho Chi Minh City]] || <nowiki>Y|other_name = <small><small>Formerly Saigon (<small><small>Vietnamese </nowiki>
|-
| [[:Jean-Daniel Lafond]] || <nowiki>Dr. Jean-Daniel Lafond<br><small><small>[[Order of Canada|CC]] </nowiki>
|-
| [[:Jorge Lorenzo]] || <nowiki>Prix career statistics==<small><small><ref name="MotoGP.com </nowiki>
|-
| [[:List of largest mosques]] || <nowiki>1}}<small><small>Masjid al-Haram, </nowiki>
|-
| [[:Lynden, Washington]] || <nowiki> = Lynden, Washington<br><small><small>[[Nooksack language|Nooksack]]:</small </nowiki>
|-
| [[:Nicole Walker]] || <nowiki>with EJ; deceased November 24, 2008)</small> </small> | grandparents </nowiki>
|-
| [[:Pogo (comics)]] || <nowiki><small>yassuh yassuh <small>yassuh...</small></small> ''[tosses baby </nowiki>
|-
| [[:Port-au-Prince]] || <nowiki> = (Vil Pòtoprens <small><small>in [[Haitian Creole </nowiki>
|-
| [[:Punjabi people]] || <nowiki>of Punjabis]]:'''<br> <small><small>1<sup>st</sup> row: </nowiki>
|-
| [[:Richard Bingham, 7th Earl of Lucan]] || <nowiki>{{Infobox Person|name = <small><small>[[The Right Honourable]]</small></small><br>Th </nowiki>
|-
| [[:Roman Empire]] || <nowiki>Former Country|native_name = <small><small>Name:</small></small><br>{{aut|Senatu </nowiki>
|-
| [[:Seoul Subway Line 1]] || <nowiki>1호선<br>首都圈 電鐵 1號線<br><small><small>''Sudogwon Jihacheol </nowiki>
|-
| [[:Sikh]] || <nowiki>= 2008-04-04}}</ref><center><small><small>Other significant </nowiki>
|-
| [[:The Circus Starring Britney Spears]] || <nowiki><small>(Canada)</small></small><ref name=jordin>{{cite </nowiki>
|-
| [[:Turkish people]] || <nowiki>|caption = <small><small> 1<sup>st</sup> row: </nowiki>
|}
=== Image description with full <nowiki><small></nowiki>. ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Adam's Bridge]] || <nowiki>[[File:The Monkeys and Bears Build a Bridge to Lanka.jpg|left|thumb|<small>A 19th century painting depicting a scene from [[Ramayana]], wherein Monkeys and Bears are shown building a bridge to [[Lanka]]</small>]] </nowiki>
|-
| [[:Architecture of metropolitan Detroit]] || <nowiki>[[File:Guardianinterior.jpg|thumb|200px|right|<small/>The [[Guardian Building]], a [[National Historic Landmark]] by [[Wirt Rowland]].</small>]] </nowiki>
|-
| [[:Charles Lindbergh]] || <nowiki>[[File:WE cover.jpg|thumb|left|125px|<small>First Edition cover</small>]] </nowiki>
|-
| [[:Christian Church]] || <nowiki>[[File:Nasrani Evolution.jpg|thumb|right || <small>Relationship of the Nasrani ([[Saint Thomas Christian tradition|Saint Thomas Christian]]) groups </small>]] </nowiki>
|-
| [[:East Germany]] || <nowiki>[[File:DDR economy-en.svg|thumb|275px|right|<small>'''The East German economy.'''</small>]] </nowiki>
|-
| [[:Flag of Scotland]] || <nowiki>[[File:Scottish Government logo.png|thumb|right|<small>[[Scottish Government]] logo</small>]] </nowiki>
|-
| [[:Florence Baptistery]] || <nowiki>[[File:South Doors Florence Baptistry schema.jpg|thumb|left|<small>'''Scenes on the south doors''' (Andrea Pisano)''' 1.''' The angel announces to Zachariah. '''2.''' Zachariah is struck mute '''3.''' Visitation '''4.''' Birth of the Baptist.''' 5.''' Zachariah writes the boy's name. '''6.''' St John as boy in the desert. '''7.''' He preaches to the Pharisees. '''8.''' He announces Christ. '''9.''' Baptism of his disciples. '''10.''' Baptism of Jesus. '''11.''' St John reprimands Herod Antipas. '''12.''' Incarceration of St. John. '''13.''' The disciples visit St. John. '''14.''' The disciples visit Jesus. '''15.''' Dance of Salome. '''16.''' Decapitation of St. John. '''17.''' Presentation of St John's head to Herod Antipas. '''18.''' Salome takes the head to Herodias '''19.''' Transport of the body of St. John. '''20.''' Burial. '''A.''' Hope '''B.''' Faith '''C.''' Charity '''D.''' Humility '''E.''' Fortitude '''F.''' Temperance '''G.''' Justice '''H.''' Prudence </small>]] </nowiki>
|-
| [[:Free will]] || <nowiki>[[File:FreeWillTaxonomy2.svg|right|thumb|250px|<small>A simplified [[taxonomy]] of the most important philosophical positions regarding free will.</small>]] </nowiki>
|-
| [[:Gloria Estefan]] || <nowiki>[[File:GloriaEstefan.jpg|right|210px|thumb|<small>Gloria Estefan performs for the crew and their families during a special event to celebrate the United Through Reading program aboard the [[Nimitz class aircraft carrier]] [[USS Theodore Roosevelt (CVN-71)]], 14 September 2006</small>]] </nowiki>
|-
| [[:Indigenous Amerindian genetics]] || <nowiki>[[File:ADN animation.gif|thumb|right|110px| <small>DNA [[double helix]]</small>]] </nowiki>
|-
| [[:Marg (magazine)]] || <nowiki>[[File:Army and Navy Building.JPG|left|thumb|140px|<small>The historic Army & Navy Building in [[Kala Ghoda]], [[Mumbai]], with Marg Publications on the third floor.</small>]] </nowiki>
|-
| [[:Monique Mayère]] || <nowiki>[[File:Charles Uhl & Monique Mayère.JPG|thumb|150px|<small>'''Monique Mayère''' (left) and Charles Uhl (right)</small>]] </nowiki>
|-
| [[:National University of San Marcos]] || <nowiki>[[File:Sanmarcos05.jpg|thumb|250px|<small>Oil regarding the founding of the University of Lima (later named San Marcos), officially the first university Peru and America, And his manager Fray Tomas de San Martin.</small>]] </nowiki>
|-
| [[:Oliver P. Smith]] || <nowiki>[[File:SmithOP DoyleJH 1950.jpg|right|thumb|180px|<small>MajGen O.P. Smith (left) and VAdm Doyle, USN, confer on board [[USS Mount McKinley (AGC-7)]], immediately prior to the Inchon Invasion.</small>]] </nowiki>
|-
| [[:Osho (Bhagwan Shree Rajneesh)]] || <nowiki>[[File:Osho Drive By.jpg|thumb|left|300px|<small>Osho greeted by sannyasins on one of his daily "drive-bys" in Rajneeshpuram, 1982.</small>]] </nowiki>
|-
| [[:Peter MacKay]] || <nowiki>[[File:Elizabeth May.jpg|100px|thumb|<small>2008 Central Nova Green Candidate, [[Elizabeth May]]</small>]] </nowiki>
|-
| [[:Pope Clement I]] || <nowiki>[[File:Saintclementmartyr.png|left|thumb|<small>Martyrdom of St Clement by [[Fungai]]</small>]] </nowiki>
|-
| [[:Puran Chand Joshi]] || <nowiki>[[File:Meerut prisoners outside the jail.jpg|thumb|600px|right|<small>'''Portrait of 25 of Meerut Prisoners taken outside the jail'''. Backrow:(left to right) K.N. Sehgal, S.S. Josh, H.L. Hutchinson, Shaukat Usmani, B.F. Bradly, A. Prasad, P. Spratt, and G. Adhikari.Middle Row: K.R. Mitra, Gopan Chakravarthy, Kishore Lal Ghosh, K.L. Kadam, D.R. Thengdi, Goura Shanker, S. Banerjee, K.N. Joglekar, [[P.C. Joshi]], and Muzaffar Ahmed.Front Row: M.G. Desai, G. Goswami, R.S. Nimkar, S.S. Mirajkar, S.A. Dange, G.V. Ghate and Gopal Basak.</small>]] </nowiki>
|-
| [[:Ratification Day (United States)]] || <nowiki>[[File:Ratification of Treaty of Paris 1784.gif|thumb|200 px|<small>Congressional Proclamation of Ratification of Treaty of Paris, Jan 14, 1784</small>]] </nowiki>
|-
| [[:Rawtenstall]] || <nowiki>[[File:Rawtenstallbusstation 001.jpg|thumb|right|<small>Rawtenstall bus station, September 2008</small>]] </nowiki>
|-
| [[:Sabre]] || <nowiki>[[File:Marxauch Sword.jpg|left|250px|thumb|<small>Lieutenant Colonel [[Teófilo Marxuach]]'s M1902 Officer's Sabre and Scabbard at the National Historic Trust site at [[Fort San Cristobal|Castillo San Cristobal]] in San Juan.</small>]] </nowiki>
|-
| [[:Suesca]] || <nowiki>[[File:RocasDeSuesca.JPG|thumb|left|221px|thumb|<small>Rocas de Suesca, Special place to whom love climbing, traking and rafting</small>]] </nowiki>
|-
| [[:Victorinox]] || <nowiki>[[File:Soldatenmesser 08-2.JPG|thumb|150px|<small>''Soldatenmesser 08'', the knife currently issued to the Swiss military</small>]] </nowiki>
|-
| [[:Wendell Cushing Neville]] || <nowiki>[[File:Wcneville-usna-photo-01.jpg|95px|left|thumb|<small>Cadet Wendell C. Neville, U.S. Naval Academy</small>]] </nowiki>
|-
| [[:Wetzikon]] || <nowiki>[[File:Pfäffikersee.JPG|thumb|left|<small>Wetzikon as seen from [[Bachtel Tower]]. [[Pfäffikersee]] in the middle, [[Greifensee]] at the left side.</small>]] </nowiki>
|}
=== Indented list ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:3rd Division (Estonia)]] || <nowiki>:*[[6th Single Infantry Battalion (Estonia)|6th Single</nowiki>
|-
| [[:3rd Mechanized Infantry Brigade (Greece)]] || <nowiki>:* HQ Company (ΙΣΤ)</nowiki>
|-
| [[:3rd Single Infantry Battalion (Estonia)]] || <nowiki>:*Signal Platoon</nowiki>
|-
| [[:4-4-6]] || <nowiki>:* [[UIC classification]]: '''2B3''' (also known as</nowiki>
|-
| [[:42 (dominoes)]] || <nowiki>:* Play is with an 8-8 set of dominoes. (You can create</nowiki>
|-
| [[:44th Street Suite]] || <nowiki>:*Recorded May 11, 1991 </nowiki>
|-
| [[:492d Bombardment Group]] || <nowiki>:*Note: Personnel and equipment of squadron were reassigned</nowiki>
|-
| [[:4Runner]] || <nowiki>:*[[4 Runner (album)|''4 Runner'' (album)]], this group's</nowiki>
|-
| [[:4th Medical Battalion (United States Marine Corps)]] || <nowiki>:* Surgical Support Company Alpha</nowiki>
|-
| [[:4th Single Infantry Battalion (Estonia)]] || <nowiki>:*Signal Platoon</nowiki>
|-
| [[:Air France Flight 447]] || <nowiki>:* the presence near the airplane’s planned route</nowiki>
|-
| [[:Attention-deficit hyperactivity disorder]] || <nowiki>:* ''Inattentive:''</nowiki>
|-
| [[:Cesar Millan]] || <nowiki>:* Firstly and most importantly, as a ''dog'' with</nowiki>
|-
| [[:Formula One]] || <nowiki>:* If under 3 laps have been completed, the race is</nowiki>
|-
| [[:Forrest A. Coburn]] || <nowiki>:* Medical School (1885-87) <ref name=cleveland/></nowiki>
|-
| [[:Franklin Pierce Rice]] || <nowiki>:* Minot Rice (1823 – ?) son of</nowiki>
|-
| [[:Jinnah International Airport]] || <nowiki>:*The '''Jinnah East Satellite Concourse''', used for</nowiki>
|-
| [[:Murder (United States law)]] || <nowiki>:#First Degree Murder: An intentional killing by means</nowiki>
|-
| [[:Octavio Gaona]] || <nowiki>:*[[Mexican National Middleweight Championship]] ([[Mexican</nowiki>
|-
| [[:Piano (Wynton Kelly album)]] || <nowiki>:*Recorded in New York City on January 31, 1958</nowiki>
|-
| [[:Piano Interpretations]] || <nowiki>:*Recorded at WOR Studios in New York City on July</nowiki>
|-
| [[:Romanian language]] || <nowiki>:* Lat. c'''e'''ra → Rom. c'''ea'''ră (wax)</nowiki>
|-
| [[:Smart Index]] || <nowiki>:*Foods with a low Smart Score number of 0-50 that</nowiki>
|-
| [[:Vladimir Salkov]] || <nowiki>:* '''Champion''' (2): 1961, 1962</nowiki>
|-
| [[:Yarlung Valley]] || <nowiki>:*'''Sheldrak Drubpuk''' (Shel brag) faces east and</nowiki>
|}
=== Interwiki before last category (AWB, IW, PY, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Abolfazl Attar]] || <nowiki>[[fa:ابوالفضل عطار]]</nowiki>
|}
=== Link with no space (AWB, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Barry Avrich]] || <nowiki>[[Media:http://www.sickkidsfoundation.com/PressReleases/downloads/News%20Release%20-%20The%20Hollywood%20Launch.pdf]] </nowiki>
|-
| [[:Fazlullah MPA]] || <nowiki>[[File:Fazlullah%20MPA.jpg|thumb|Fazlullah MPA]] </nowiki>
|-
| [[:Hershey Breasts Bikini]] || <nowiki>[[http://scrapetv.com/News/News%20Pages/Everyone%20Else/images-2/Hershey-Breasts-Bikini.jpg]] </nowiki>
|-
| [[:Janaka Selekta]] || <nowiki>[[Media:http://janakaselekta.net/Press/35%20Electrobuzz.pdf.]] </nowiki>
|-
| [[:Kuwait Airways]] || <nowiki>[[Image:Kuwait%20Airways.jpg|thumb|Kuwait Airways [[A340]] landing]] </nowiki>
|-
| [[:List of deserts by area]] || <nowiki>[[Image:Namib%20desert%20MODIS.jpg|100px]] </nowiki>
|-
| [[:Marc L. Marks]] || <nowiki>[[Media:http://www.nytimes.com/1982/07/26/opinion/l-americans-at-the-brink-of-street-protests-036526.html?n=Top/Reference/Times%20Topics/Subjects/D/Demonstrations%20and%20Riots]] </nowiki>
|-
| [[:Tamaskan wolf dog]] || <nowiki>[[http://www.the-no-wolf-tamaskan-fable.com/Pedigree%20Summary-1.pdf Pedigree History of the Tamaskan Wolfdog]] </nowiki>
|}
=== Reference before punctuation ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Action of 19 December 1796]] || <nowiki></ref>. However the Spanish accounts give only two</nowiki>
|-
| [[:Aether drag hypothesis]] || <nowiki></ref>. It is the present version of Aether drag,</nowiki>
|-
| [[:Air France Flight 447]] || <nowiki></ref>. The second phase of the search ended on 20</nowiki>
|-
| [[:Alpinumisoflavone]] || <nowiki></ref>. It can also be found in the [[molluscicide]]</nowiki>
|-
| [[:Apgar Village]] || <nowiki></ref>.Apgar Village also has two small hotel buildings,</nowiki>
|-
| [[:Arthur Maia]] || <nowiki></ref>. His compositions usually presents a fusion</nowiki>
|-
| [[:Calycosin]] || <nowiki></ref>.==Biosynthesis==[[Isoflavone 3'-hydroxylase]]</nowiki>
|-
| [[:Centre for Excellence in Telecom Technology and Management (CETTM)]] || <nowiki></ref>.* Regional Telecom Training Centres (RTTC's)</nowiki>
|-
| [[:Delhi School of Management]] || <nowiki></ref>. It has the latest facilities including a state-of-the-art</nowiki>
|-
| [[:EPUBReader]] || <nowiki></ref>.This add-on opens the ePub file just like you</nowiki>
|-
| [[:Everton da Silva Oliveira]] || <nowiki></ref>.==References=={{reflist}}{{DEFAULTSORT:Everton}}[[Category:1983</nowiki>
|-
| [[:Fare Deal Entertainments]] || <nowiki></ref>.The agency has acts from all over the country</nowiki>
|-
| [[:La journée de la jupe]] || <nowiki></ref>.* Interestingly, the movie was first broadcast</nowiki>
|-
| [[:Millettia thonningii]] || <nowiki></ref>.==References=={{reflist}}==External links=={{wikispecies}}[[Category:Millettia]]{{Faboideae-stub}</nowiki>
|-
| [[:Ormosia excelsa]] || <nowiki></ref>.==References=={{reflist}}==External links=={{wikispecies}}[[Category:Ormosia]]{{Faboideae-stub}</nowiki>
|-
| [[:Penguin Celebrations]] || <nowiki></ref>. Following the 1940s style; Green is for 'mystery',</nowiki>
|-
| [[:Portland (communications)]] || <nowiki></ref>.== Clients ==Portland is employed by several</nowiki>
|-
| [[:Prunetin]] || <nowiki></ref>. Prunetin isolated from [[Pisum sativum|pea]]</nowiki>
|-
| [[:Pseudobaptigenin]] || <nowiki></ref>. ==References=={{reflist}}{{isoflavone}}[[category:isoflavones]]{{polyphenol-stub}</nowiki>
|-
| [[:R. Scott Morris]] || <nowiki></ref>. In 2002, he lectured on volume-price ratios</nowiki>
|-
| [[:Rachel Messerer]] || <nowiki></ref>. In early March 1938 Rachel was arrested.</nowiki>
|-
| [[:The AIRSCREEN Company GmbH & Co. KG]] || <nowiki></ref>. Also as a consequence of this many film events</nowiki>
|-
| [[:The Real Adventures of Zetaman]] || <nowiki></ref>. It chronicles Illya "Zetaman" King's adventures</nowiki>
|-
| [[:VEXNEWS]] || <nowiki></ref>. Landeryou also broke a major story drawing</nowiki>
|-
| [[:Vonnegut & Bohn]] || <nowiki></ref>. All the partners were German Americans and</nowiki>
|}
=== Reference list duplication ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2005 Boxing World Cup]] || <nowiki> <references/></nowiki><br /><nowiki> <references/> </nowiki>
|-
| [[:2008 PBA Draft]] || <nowiki> <references /></nowiki><br /><nowiki>proven otherwise. ==References== <references /> </nowiki>
|-
| [[:Anseris Mons]] || <nowiki>image-caption}}]] <br /> ---- <references/></nowiki><br /><nowiki><references/> </nowiki>
|-
| [[:Edward Gilbert Abbott]] || <nowiki>Day Pain Died External Article] <references/></nowiki><br /><nowiki> <references/> </nowiki>
|}
=== Template coding tags without content ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1984–85 Boston Celtics season]] || <nowiki><noinclude></noinclude><ref>http://www.basketball-reference.com/teams/BOS/1985.html</ref>==Depth</nowiki>
|-
| [[:2000 AF2 season]] || <nowiki><noinclude></noinclude>The '''2000 AF2 season''' was the very first season of the</nowiki>
|-
| [[:2001 AF2 season]] || <nowiki><noinclude></noinclude>The '''2001 AF2 season''' was the second season of the [[AF2]].</nowiki>
|-
| [[:2002 AF2 season]] || <nowiki><noinclude></noinclude>The '''2002 AF2 season''' was the third season of the [[AF2]].</nowiki>
|-
| [[:2003 AF2 season]] || <nowiki><noinclude></noinclude>The '''2003 AF2 season''' was the fourth season of the [[AF2]].</nowiki>
|-
| [[:2004 AF2 season]] || <nowiki><noinclude></noinclude>The '''2004 AF2 season''' was the fifth season the [[AF2]].</nowiki>
|-
| [[:2005 AF2 season]] || <nowiki><noinclude></noinclude>The '''2005 AF2 season''' was the sixth season of the [[AF2]].</nowiki>
|-
| [[:2005–06 Boston Celtics season]] || <nowiki><noinclude></noinclude>==Depth chart====Regular season=====Season standings==={{2005-06</nowiki>
|-
| [[:2006 AF2 season]] || <nowiki><noinclude></noinclude>The '''2006 AF2 season''' was the seventh season of the [[AF2]],</nowiki>
|-
| [[:2006 Tampa Bay Storm season]] || <nowiki><noinclude></noinclude>{{Infobox NFL_season| team = Tampa Bay Storm| year = 2006|</nowiki>
|-
| [[:2006–07 Ashes series]] || <nowiki><noinclude></noinclude>{{Australian cricket in 2006-07}}{{Ashes Test series}}{{International</nowiki>
|-
| [[:2007 AF2 season]] || <nowiki><noinclude></noinclude>The '''2007 AF2 season''' was the eighth season of the [[AF2]].</nowiki>
|-
| [[:2008 AF2 season]] || <nowiki><noinclude></noinclude>The '''2008 AF2 season''' was the ninth season of the [[AF2]].</nowiki>
|-
| [[:2008 Connecticut Sun season]] || <nowiki><noinclude></noinclude>==Regular Season Statistics=={{WNBA roster statistics legend}}===Player</nowiki>
|-
| [[:2008–09 Portland Trail Blazers season]] || <nowiki><noinclude></noinclude>==Depth chart=={{2008–09 Portland Trail Blazers depth</nowiki>
|-
| [[:5, 6, 7, 8 – Bullenstaat!]] || <nowiki><includeonly></includeonly></nowiki>
|-
| [[:DVB-S2]] || <nowiki><noinclude></noinclude>based on the [[concatenated code|concatenation]] of the [[BCH</nowiki>
|-
| [[:European Students Conference]] || <nowiki><noinclude></noinclude>'''European Students' Conference''' (ESC) is an international</nowiki>
|-
| [[:Hendrik Verwoerd]] || <nowiki><noinclude></noinclude> {{Persondata|NAME=</nowiki>
|-
| [[:Kang Deouk-Soo]] || <nowiki><noinclude></noinclude>[[Category:1986 FIFA World Cup squad templates|Korea, South]][[Category:South</nowiki>
|-
| [[:List of Kyo Kara Maoh! characters]] || <nowiki><includeonly></includeonly>, his older brother Shori,<ref name="ep72"/> and even</nowiki>
|-
| [[:Saroj signh]] || <nowiki><includeonly></includeonly>== Career ==Before becoming a television presenter Crawford</nowiki>
|-
| [[:Sex and the law]] || <nowiki><includeonly></includeonly>{{Redirect|Sex crime|the Eurythmics song|Sexcrime (Nineteen</nowiki>
|-
| [[:Tennessee Volunteers football]] || <nowiki><includeonly></includeonly>}}The '''Tennessee Volunteers''' are an [[United States|American]]</nowiki>
|-
| [[:Torrey Pines High School]] || <nowiki><noinclude></noinclude> and Water Polo. On October 11, 2007, Torrey Pines football</nowiki>
|}
=== Template value ends with break (AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Akeem Omolade]] || <nowiki>caps(goals)=…{{0}}(2)<br /></nowiki>
|-
| [[:Akinori Nakagawa]] || <nowiki>Genre=…[[R&B]]<br/></nowiki>
|-
| [[:Al Jazeera Sports]] || <nowiki>sister names=…Sports Clubs<br /></nowiki>
|-
| [[:Asmalı Konak]] || <nowiki>writer=…Ergun]]<br /></nowiki>
|-
| [[:Athol Richardson]] || <nowiki>honorific-prefix=…</br></nowiki>
|-
| [[:Cesar Millan]] || <nowiki>quote=…dog anymore.''<br></nowiki>
|-
| [[:Everton da Silva Oliveira]] || <nowiki>caps(goals)=…<br/> <br/></nowiki>
|-
| [[:Gordon O'Connor]] || <nowiki>honorific-prefix=…rable]]</small><br></nowiki>
|-
| [[:Hannah Montana (season 3)]] || <nowiki>ShortSummary=…of the show.<br /></nowiki>
|-
| [[:Ilario Cozzi]] || <nowiki>caps(goals)=…/>52 (2)<br /></nowiki>
|-
| [[:John Jennissen]] || <nowiki>Instrument=…]]<br>[[Piano]]<br></nowiki>
|-
| [[:Labyrinth Brigade]] || <nowiki>Released=…March 16, 2010 <br></nowiki>
|-
| [[:Mathew Olorunleke]] || <nowiki>caps(goals)=…{{0}}(0)<br /></nowiki>
|-
| [[:No Hope, No Future]] || <nowiki>Last album=…You Speak<br /></nowiki>
|-
| [[:Omni (album)]] || <nowiki>Released=…May 4, 2010<br/></nowiki>
|-
| [[:One Eyed King]] || <nowiki>starring=…Palminteri]]<br></nowiki>
|-
| [[:Psammobates]] || <nowiki>image_caption=…ometricus]]'')</br></nowiki>
|-
| [[:Shōnan no Kaze discography]] || <nowiki>0=…ncehall-han]]"<br/></nowiki>
|-
| [[:Symbolic (Death album)]] || <nowiki>Last album=…]''<br/>(1993)<br/></nowiki>
|-
| [[:The Blackshear Times]] || <nowiki>headquarters=…/></nowiki>
|-
| [[:The Sound of Perseverance]] || <nowiki>Last album=…]''<br/>(1995)<br/></nowiki>
|-
| [[:Valmore A. Whitaker]] || <nowiki>order=…4th (Acting)<br></nowiki>
|-
| [[:WWII in HD]] || <nowiki>starring=…Zahn]]<br></nowiki>
|-
| [[:Zoran levnaic]] || <nowiki>caps(goals)=… 25 (3) <br></nowiki>
|-
| [[:Zoran Levnaić]] || <nowiki>caps(goals)=… 25 (3) <br></nowiki>
|}
=== Title linked in text (AWB, AutoEd, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:American Idiot World Tour]] || <nowiki>[[American Idiot World Tour]] • [[21st Century Breakdown</nowiki>
|-
| [[:Asian Dreamer]] || <nowiki>[[Asian Dreamer|The Album named after it]]| music10</nowiki>
|-
| [[:Bhanbhro]] || <nowiki>[[Bhanbhro]] tribes. The [[Bhanbhra Welfare Association]]</nowiki>
|-
| [[:List of Spanish number-one hits of 2010]] || <nowiki>[[List of Spanish number-one hits of 2010|2010]]</span></div>}}<noinclude>[[Category:Record</nowiki>
|-
| [[:Megalophaedusa]] || <nowiki>[[Megalophaedusa]]''| genus_authority = [[Oskar Boettger|Boettger]],</nowiki>
|-
| [[:Mesopropithecus]] || <nowiki>[[Mesopropithecus]]''''' |1={{Clade</nowiki>
|-
| [[:Nickelodeon (Czech)]] || <nowiki>[[Nickelodeon (Czech)]] has finally been launched!==History==Nickelodeon</nowiki>
|-
| [[:Ohio 123rd General Assembly]] || <nowiki>[[Ohio 123rd General Assembly|123rd]]}}{{•}}{{nowrap|[[Ohio</nowiki>
|-
| [[:Samten Migdrön]] || <nowiki>[[Samten Migdrön]]'' (Tib. ''bsam gtan mig sgron'').<ref>Norbu,</nowiki>
|}
[[af:Wikipedia:WikiProject Check Wikipedia]]
[[ar:ويكيبيديا:فحص ويكيبيديا]]
[[ca:Viquipèdia:WikiProject Check Wikipedia]]
[[cs:Wikipedie:WikiProjekt Check Wikipedia]]
[[cy:Wicipedia:WikiProject Check Wikipedia]]
[[da:Wikipedia:WikiProjekt Check Wikipedia]]
[[de:Wikipedia:WikiProjekt Syntaxkorrektur]]
[[eo:Projekto:Check Wikipedia]]
[[es:Wikiproyecto:Check Wikipedia]]
[[fi:Wikipedia:Wikiprojekti Check Wikipedia]]
[[fr:Projet:Correction syntaxique]]
[[fy:Meidogger:Stefan Kühn/WikiProject Check Wikipedia]]
[[he:ויקיפדיה:Check Wikipedia]]
[[hu:Wikipédia:Ellenőrzőműhely]]
[[id:Wikipedia:ProyekWiki Cek Wikipedia]]
[[is:Wikipedia:WikiProject Check Wikipedia]]
[[it:Wikipedia:Elenchi generati offline/Check Wikipedia]]
[[ja:Wikipedia:ウィキプロジェクト ウィキ文法のチェック]]
[[la:Vicipaedia:WikiProject Check Wikipedia]]
[[nds:Wikipedia:WikiProject Check Wikipedia]]
[[nds-nl:Wikipedie:WikiProject Check Wikipedia]]
[[nl:Wikipedia:Wikiproject/Check Wikipedia]]
[[no:Wikipedia:WikiProject Check Wikipedia]]
[[pdc:Wikipedia:WikiProject Check Wikipedia]]
[[pl:Wikiprojekt:Check Wikipedia]]
[[pt:Wikipedia:Projetos/Check Wikipedia]]
[[ro:Wikipedia:WikiProject Check Wikipedia]]
[[ru:Википедия:Страницы с ошибками в викитексте]]
[[sk:Wikipédia:WikiProjekt Check Wikipedia]]
[[sv:Wikipedia:Projekt wikifiering/Syntaxfel]]
[[tr:Vikipedi:Vikipedi proje kontrolü]]
[[uk:Вікіпедія:Проект:Check Wikipedia]]
[[zh:维基百科:错误检查专题]]