This is the local page (enwiki) of the project "[[de:Benutzer:Stefan Kühn/Check Wikipedia|Check Wikipedia]]".
* Data from the CW-database at the time: '''2010-02-10 00:00''' (GMT, Toolserver)
* More features and statistics in the <span style="background-color:yellow;">[http://toolserver.org/~sk/cgi-bin/checkwiki/checkwiki.cgi new interface]</span>
* In the future this output will not be supported. Please change your page into your local projectpage. All data will be available in the new interface.
* Daily you can found an update of this page [http://toolserver.org/~sk/checkwiki/enwiki/enwiki_output_for_wikipedia.html here].
* Please change the translation page so that you can work with the translation in the new interface (XHTML).
== Highest Priority ==
=== Code not correct end ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:List of homing endonuclease cutting sites]] || <nowiki><code> 5' AAATTGCTTGCAAACAGCTATTACGGCTAT </br> 3' </nowiki>
|-
| [[:List of restriction enzyme cutting sites]] || <nowiki><code> 5' CGGCCG </br> 3' GCCGGC| <code> 5' ---C </nowiki>
|-
| [[:Loop device]] || <nowiki><code>loop: can't delete device /dev/loop0: Device</nowiki>
|-
| [[:Wikipedia:Categories for discussion/Log/2009 June 10]] || <nowiki><code>is essential to the occupation.<code>":Als</nowiki>
|-
| [[:Wikipedia:Featured list candidates/Timeline of the 1996 Atlantic hurricane season/archive1]] || <nowiki><code>|alt=Map showing paths of tropical cylcones </nowiki>
|-
| [[:Wikipedia:Gadget/proposals]] || <nowiki><code>importScript("User:Endo999/GoogleTrans.js");</nowiki>
|-
| [[:Wikipedia:Help desk/Archives/2009 August 25]] || <nowiki><code> </nowiki>
|-
| [[:Wikipedia:Help desk/Archives/2009 June 3]] || <nowiki><code> </nowiki>
|-
| [[:Wikipedia:Help desk/Archives/2009 September 27]] || <nowiki><code> <</nowiki>
|-
| [[:Wikipedia:Village pump (miscellaneous)/Archive 19]] || <nowiki><code> </nowiki>
|}
=== Headline should end with "=" ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Christian sorority]] || <nowiki>==While the traditional women's fraternity or [[sorority]] was founded well before</nowiki>
|-
| [[:Kazakhstan at the 2010 Winter Olympics]] || <nowiki>==[[Image:Ski Jumping pictogram.svg|30px|alt=|link=]] </nowiki>
|-
| [[:Lucky Lager]] || <nowiki>==F**K THE REST, LUCKY IS THE BEST!</nowiki>
|}
=== Headlines all start with three "=" (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010–11 Primera División de México season]] || <nowiki>===Clubs===</nowiki>
|-
| [[:Alter Bridge discography]] || <nowiki>===Studio albums===</nowiki>
|-
| [[:Armoured Vehicle Tracked Light Repair]] || <nowiki>===Specification===</nowiki>
|-
| [[:Atletico Chiriquí B]] || <nowiki>===Club Atletico Chiriquí II===</nowiki>
|-
| [[:Bedford Park Rangers F.C.]] || <nowiki>===Current squad===</nowiki>
|-
| [[:Beef Supreme]] || <nowiki>=== Discography ===</nowiki>
|-
| [[:Canadian Naval Reserve]] || <nowiki>===See also===</nowiki>
|-
| [[:Cecile Walton]] || <nowiki>====External links====</nowiki>
|-
| [[:Christina Schilling]] || <nowiki>====Entries in national Eurovision preselections====</nowiki>
|-
| [[:Concept Web Alliance]] || <nowiki>===[http://www.nbic.nl/ NBIC] and CWA===</nowiki>
|-
| [[:Edward Arthur Walton]] || <nowiki>====Bibliography====</nowiki>
|-
| [[:Geopark Shetland]] || <nowiki>====Features====</nowiki>
|-
| [[:George Henry Walton]] || <nowiki>====Bibliography====</nowiki>
|-
| [[:Kfar Kidde]] || <nowiki>===Notes===</nowiki>
|-
| [[:Ovacık, Lüleburgaz]] || <nowiki>===History===</nowiki>
|-
| [[:Pennant Measures]] || <nowiki>===References===</nowiki>
|-
| [[:R.A.L.P.H.]] || <nowiki>===R.A.L.P.H.===</nowiki>
|-
| [[:Recovery software]] || <nowiki>===Bootable===</nowiki>
|-
| [[:Sikhism In Malaysia]] || <nowiki>===Early Sikh Pioneers===</nowiki>
|-
| [[:Sonny With A Chance:The Movie]] || <nowiki>===Cast===</nowiki>
|-
| [[:The City Of Ember 2:People Of Sparks]] || <nowiki>===Info===</nowiki>
|-
| [[:Thomas Keith]] || <nowiki>====References====</nowiki>
|-
| [[:Timothy McDarrah]] || <nowiki>===References===</nowiki>
|-
| [[:William Skeoch Cumming]] || <nowiki>====References====</nowiki>
|-
| [[:William York Macgregor]] || <nowiki>====References====</nowiki>
|}
=== Headlines start with one "=" (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2009 Al Anbar VBIED Campaign]] || <nowiki>=Source=</nowiki>
|-
| [[:9mm Parabellum Bullet]] || <nowiki>=Formation and Early Releases (2005 - 2006)=</nowiki>
|-
| [[:Ahoora]] || <nowiki>=History=</nowiki>
|-
| [[:Ballymena Academy History Department]] || <nowiki>=Ballymena Academy History Department=</nowiki>
|-
| [[:Centered System of Sets]] || <nowiki>=Definition=</nowiki>
|-
| [[:Company Level Intelligence Cell]] || <nowiki>=Source=</nowiki>
|-
| [[:International football players with dual citizenship]] || <nowiki>=Europe=</nowiki>
|-
| [[:IUCN Red List conservation dependent species]] || <nowiki>=[[Animalia]]=</nowiki>
|-
| [[:IUCN Red List near threatened species]] || <nowiki>=[[Animalia]]=</nowiki>
|-
| [[:John May (Angel Investor)]] || <nowiki>= John May = </nowiki>
|-
| [[:List of US politicians with Confederate ancestry]] || <nowiki>=References=</nowiki>
|-
| [[:Margarita (given name)]] || <nowiki>=See also==</nowiki>
|-
| [[:Meteograms]] || <nowiki>=OVERVIEW=</nowiki>
|-
| [[:Midreshet Aviv]] || <nowiki>=External Links=</nowiki>
|-
| [[:Operation Al Majid]] || <nowiki>=Source=</nowiki>
|-
| [[:Operation Defeat Al Qaeda in the North]] || <nowiki>=Source=</nowiki>
|-
| [[:Operation Guardian Tiger IV]] || <nowiki>=Source=</nowiki>
|-
| [[:Parveen Kumar]] || <nowiki>=References=</nowiki>
|-
| [[:Samsung SGH-T100]] || <nowiki>= References =</nowiki>
|-
| [[:Skybuilt Power]] || <nowiki>= Summary =</nowiki>
|-
| [[:Steve propes]] || <nowiki>=Books=</nowiki>
|-
| [[:Tammy Williams]] || <nowiki>= College =</nowiki>
|-
| [[:Thalavoor Trikkonnamarcodu Sri Durga Devi temple]] || <nowiki>=more external links=</nowiki>
|-
| [[:Universal Insurance company Limited]] || <nowiki>=Introduction=</nowiki>
|-
| [[:Vania Rossi]] || <nowiki>=References=</nowiki>
|}
=== Headlines start with three "=" and later with level two ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:497th Air Refueling Wing]] || <nowiki>===Lineage===</nowiki>
|-
| [[:ADD-TV]] || <nowiki>===ADD-TV===</nowiki>
|-
| [[:Arnab Basu]] || <nowiki>=====Education=====</nowiki>
|-
| [[:Galway to Graceland]] || <nowiki>===Track listing===</nowiki>
|-
| [[:Glammy Awards]] || <nowiki>===THE GLAMMY Awards===</nowiki>
|-
| [[:Google Street View Privacy Concerns]] || <nowiki>=== United States ===</nowiki>
|-
| [[:Graffiti (Chris Brown album)]] || <nowiki>===Concept and themes===</nowiki>
|-
| [[:Hawk Mill, Shaw]] || <nowiki>===Location===</nowiki>
|-
| [[:History of Kathmandu]] || <nowiki>===Ancient history===</nowiki>
|-
| [[:History of the Astor House Hotel, Shanghai 1858-1900]] || <nowiki>===Peter Felix Richards (1858–1861)===</nowiki>
|-
| [[:Leica Standard]] || <nowiki>===The Standard===</nowiki>
|-
| [[:List of films based on civics books]] || <nowiki>===Unclassified===</nowiki>
|-
| [[:List of seaweeds of South Africa]] || <nowiki>==Kingdom: [[Plantae]] — Division: [[Chlorophyta]] — Green seaweeds===</nowiki>
|-
| [[:Melbourne Heart season 2010–11]] || <nowiki>===Current Squad For 2010-11 Season===</nowiki>
|-
| [[:Mike Walker's Name Tag America]] || <nowiki>===History of Mike and Mike Name Tag America: 2001===</nowiki>
|-
| [[:Oklahoma gubernatorial election, 1998]] || <nowiki>===Results===</nowiki>
|-
| [[:Oklahoma gubernatorial election, 2002]] || <nowiki>===Results===</nowiki>
|-
| [[:Pamantasang Mahal]] || <nowiki>===Lyrics===</nowiki>
|-
| [[:Peter Batey]] || <nowiki>===Early Career===</nowiki>
|-
| [[:Pill Awards]] || <nowiki>===The Pill Awards===</nowiki>
|-
| [[:Refinery row]] || <nowiki>===Canada===</nowiki>
|-
| [[:ReW & WhO?]] || <nowiki>===ReW & WhO?===</nowiki>
|-
| [[:Royton Ring Mill, Royton]] || <nowiki>===Location===</nowiki>
|-
| [[:Visa requirements for South African citizens]] || <nowiki>===Africa===</nowiki>
|-
| [[:Vladimir Stoyanov Will]] || <nowiki>===Biology and Genetics===</nowiki>
|}
=== ISBN wrong checksum in ISBN-10 ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:320 mm Model 1934 naval gun]] || <nowiki>385-0-7247-0-3</nowiki> || <nowiki>3 vs. 0 (165 mod 11) </nowiki>
|-
| [[:381mm / 50 Model 1934 naval gun]] || <nowiki>385-0-7247-0-3</nowiki> || <nowiki>3 vs. 0 (165 mod 11) </nowiki>
|-
| [[:Jimmy Kerr]] || <nowiki>1 86200 013 3</nowiki> || <nowiki>3 vs. 1 (78 mod 11) </nowiki>
|-
| [[:John Charles Vockler]] || <nowiki>0108153674</nowiki> || <nowiki>4 vs. 3 (201 mod 11) </nowiki>
|-
| [[:John Lynch (Mayor)]] || <nowiki>0906312509</nowiki> || <nowiki>9 vs. 7 (117 mod 11) </nowiki>
|-
| [[:Kukuraja]] || <nowiki>0-86171-199-9</nowiki> || <nowiki>9 vs. 8 (239 mod 11) </nowiki>
|-
| [[:Kukuraja]] || <nowiki>81-215-0377-X</nowiki> || <nowiki>X vs. 9 (185 mod 11) </nowiki>
|-
| [[:Kukuraja]] || <nowiki>0-86171-199-9</nowiki> || <nowiki>9 vs. 8 (239 mod 11) </nowiki>
|-
| [[:Marius Grout]] || <nowiki>2729572594</nowiki> || <nowiki>4 vs. 7 (260 mod 11) </nowiki>
|-
| [[:Robert Siciliano]] || <nowiki>1-990427-00-4</nowiki> || <nowiki>4 vs. 6 (127 mod 11) </nowiki>
|-
| [[:Robuck Lynch]] || <nowiki>0906312509</nowiki> || <nowiki>9 vs. 7 (117 mod 11) </nowiki>
|-
| [[:Singh]] || <nowiki>81-7033-273-8</nowiki> || <nowiki>8 vs. 7 (161 mod 11) </nowiki>
|-
| [[:South Carolina]] || <nowiki>1-57003-598-2</nowiki> || <nowiki>2 vs. 9 (229 mod 11) </nowiki>
|-
| [[:Squid]] || <nowiki>95-5-105267-0</nowiki> || <nowiki>0 vs. 6 (193 mod 11) </nowiki>
|-
| [[:Subhuti]] || <nowiki>0-0847-0901-7</nowiki> || <nowiki>7 vs. 4 (147 mod 11) </nowiki>
|-
| [[:Tchaikovsky and the Belyayev circle]] || <nowiki>0-393-07535-2</nowiki> || <nowiki>2 vs. 4 (191 mod 11) </nowiki>
|-
| [[:Tea]] || <nowiki>0-907061-05-0</nowiki> || <nowiki>0 vs. 2 (134 mod 11) </nowiki>
|-
| [[:Tennis]] || <nowiki>0-07024-625-9</nowiki> || <nowiki>9 vs. 4 (158 mod 11) </nowiki>
|-
| [[:Terri Donovan Mansfield]] || <nowiki>142522550-6</nowiki> || <nowiki>6 vs. 0 (132 mod 11) </nowiki>
|-
| [[:The 2i's Coffee Bar]] || <nowiki>0-86105-140-9</nowiki> || <nowiki>9 vs. 8 (107 mod 11) </nowiki>
|-
| [[:The Gambia]] || <nowiki>91-947010-4-8</nowiki> || <nowiki>8 vs. 0 (132 mod 11) </nowiki>
|-
| [[:Thomas Lynch (Mayor)]] || <nowiki>0906312509</nowiki> || <nowiki>9 vs. 7 (117 mod 11) </nowiki>
|-
| [[:Toyota]] || <nowiki>0-947079-908</nowiki> || <nowiki>8 vs. 4 (235 mod 11) </nowiki>
|-
| [[:Walloons]] || <nowiki>2-8011-0085-9</nowiki> || <nowiki>9 vs. 4 (136 mod 11) </nowiki>
|-
| [[:William Clark (explorer)]] || <nowiki>0-8061-3911-1</nowiki> || <nowiki>1 vs. 0 (143 mod 11) </nowiki>
|}
=== ISBN wrong checksum in ISBN-13 ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:20000 Varuna]] || <nowiki>987-0-8165-2755-7</nowiki> || <nowiki>7 vs. 5 </nowiki>
|-
| [[:Battle of Mohács]] || <nowiki>0075434536776</nowiki> || <nowiki>6 vs. 7 </nowiki>
|-
| [[:Biblical inerrancy]] || <nowiki>978-0-10-280290-3</nowiki> || <nowiki>3 vs. 0 </nowiki>
|-
| [[:Bread]] || <nowiki>9780822338335</nowiki> || <nowiki>5 vs. 8 </nowiki>
|-
| [[:Canada–Haiti relations]] || <nowiki>978-2-2620154-0-6</nowiki> || <nowiki>6 vs. 4 </nowiki>
|-
| [[:Change management]] || <nowiki>978-0-9767359-0-3</nowiki> || <nowiki>3 vs. 8 </nowiki>
|-
| [[:E-scape]] || <nowiki>978-1-904158-63-3</nowiki> || <nowiki>3 vs. 9 </nowiki>
|-
| [[:Fourth Realm Trilogy]] || <nowiki>978-0-385-51439-9</nowiki> || <nowiki>9 vs. 2 </nowiki>
|-
| [[:Haiti]] || <nowiki>978-2-2620154-0-6</nowiki> || <nowiki>6 vs. 4 </nowiki>
|-
| [[:Henry Kissinger]] || <nowiki>973-3-940405-70-8</nowiki> || <nowiki>8 vs. 3 </nowiki>
|-
| [[:History of the Luftwaffe (1933–1945)]] || <nowiki>978-1-903223-71-7</nowiki> || <nowiki>7 vs. 0 </nowiki>
|-
| [[:Murray John Mills]] || <nowiki>9780713672576</nowiki> || <nowiki>6 vs. 2 </nowiki>
|-
| [[:Niccolò Machiavelli]] || <nowiki>978-0-934941-003</nowiki> || <nowiki>3 vs. 6 </nowiki>
|-
| [[:Operation Barbarossa]] || <nowiki>9870375724718</nowiki> || <nowiki>8 vs. 6 </nowiki>
|-
| [[:Paris Métro]] || <nowiki>978-1-85414-322-0</nowiki> || <nowiki>0 vs. 8 </nowiki>
|-
| [[:Phrarajbhavanavisudh]] || <nowiki>978-974-94783-0-4</nowiki> || <nowiki>4 vs. 1 </nowiki>
|-
| [[:QF 12 pounder 12 cwt naval gun]] || <nowiki>978-1-84067-529-2</nowiki> || <nowiki>2 vs. 0 </nowiki>
|-
| [[:Robert Siciliano]] || <nowiki>978-0-07-069614-0</nowiki> || <nowiki>0 vs. 3 </nowiki>
|-
| [[:Samuel Fox (1781-1868)]] || <nowiki>978-1850723672</nowiki> || <nowiki>2 vs. 7 </nowiki>
|-
| [[:Scattered disc]] || <nowiki>987-0-8165-2755-7</nowiki> || <nowiki>7 vs. 5 </nowiki>
|-
| [[:Singaporean Hokkien]] || <nowiki>9787561516924</nowiki> || <nowiki>4 vs. 8 </nowiki>
|-
| [[:Theoren Fleury]] || <nowiki>978-1-55469-239-3</nowiki> || <nowiki>3 vs. 2 </nowiki>
|-
| [[:Virgin birth of Jesus]] || <nowiki>978-0-10-280290-3</nowiki> || <nowiki>3 vs. 0 </nowiki>
|-
| [[:Virginia units in the Civil War]] || <nowiki>978-0930919661</nowiki> || <nowiki>1 vs. 5 </nowiki>
|-
| [[:Virginia units in the Civil War]] || <nowiki>978-0930919653</nowiki> || <nowiki>3 vs. 8 </nowiki>
|}
=== ISBN wrong length ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Forced labor of Germans after World War II]] || <nowiki>13</nowiki> || <nowiki>2 </nowiki>
|-
| [[:French Circe class submarine]] || <nowiki>0 85177</nowiki> || <nowiki>6 </nowiki>
|-
| [[:Industrial Revolution]] || <nowiki>978-2-296-0339-8</nowiki> || <nowiki>12 </nowiki>
|-
| [[:Introduction to quantum mechanics]] || <nowiki>0-452-28457</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Jorge Orta, Artist]] || <nowiki>10-1-904772-75-0</nowiki> || <nowiki>12 </nowiki>
|-
| [[:Karma in Buddhism]] || <nowiki>0-203-45117</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1920–1922]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1922–1925]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1925–1927]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1927–1930]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Museum Franz Gertsch]] || <nowiki>3-952243-3-5</nowiki> || <nowiki>9 </nowiki>
|-
| [[:New South Wales state election, 1930]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:New South Wales state election, 1932]] || <nowiki>052284700</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Polyethylene terephthalate]] || <nowiki>978352730113</nowiki> || <nowiki>12 </nowiki>
|-
| [[:Rodelinda (6th century)]] || <nowiki>4890267</nowiki> || <nowiki>7 </nowiki>
|-
| [[:Stefan Szczesny]] || <nowiki>978-3-980881-9-6</nowiki> || <nowiki>12 </nowiki>
|-
| [[:The Harvest (Boondox album)]] || <nowiki>756504406120</nowiki> || <nowiki>12 </nowiki>
|-
| [[:The Holocaust]] || <nowiki>348656384</nowiki> || <nowiki>9 </nowiki>
|-
| [[:The Holocaust]] || <nowiki>348656384</nowiki> || <nowiki>9 </nowiki>
|-
| [[:The Holocaust]] || <nowiki>348656384</nowiki> || <nowiki>9 </nowiki>
|-
| [[:The Holocaust]] || <nowiki>348656384</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Timeline of historic inventions]] || <nowiki>4-274-0231401</nowiki> || <nowiki>11 </nowiki>
|-
| [[:Venom (band)]] || <nowiki>184520399</nowiki> || <nowiki>9 </nowiki>
|-
| [[:Volubilis]] || <nowiki>978-700-9840-2</nowiki> || <nowiki>11 </nowiki>
|-
| [[:Woodrow Wilson]] || <nowiki>0021-8723</nowiki> || <nowiki>8 </nowiki>
|}
=== ISBN wrong position of X ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Boulton Paul Defiant]] || <nowiki>X-9999-0042-X </nowiki>
|-
| [[:Constitutional convention (political custom)]] || <nowiki>19876202X </nowiki>
|-
| [[:Culture of Iran]] || <nowiki>1568591772 x </nowiki>
|-
| [[:Fauna of Scotland]] || <nowiki>0224033961X </nowiki>
|-
| [[:Formal language]] || <nowiki>0-201-029880-X </nowiki>
|-
| [[:Friedrich Nietzsche]] || <nowiki>0-08078-8085-X </nowiki>
|-
| [[:Geology of the North Sea]] || <nowiki>0-4444-50611-X </nowiki>
|-
| [[:George Gershwin]] || <nowiki>10075675660X </nowiki>
|-
| [[:Harrison Slater]] || <nowiki>0-150100580-X </nowiki>
|-
| [[:Ivan Engler]] || <nowiki>388778-2002x </nowiki>
|-
| [[:Jan Zweyer]] || <nowiki>978-389425212X </nowiki>
|-
| [[:Meltem Arıkan]] || <nowiki>978-605-111-228-X </nowiki>
|-
| [[:Memorial Grounds]] || <nowiki>1 8999890 19 X </nowiki>
|-
| [[:Oshki]] || <nowiki>10075465740X </nowiki>
|-
| [[:Polyploidy]] || <nowiki>10 0-471-69939-X </nowiki>
|-
| [[:Shinkyoku Sōkai Polyphonica]] || <nowiki>978479733780X </nowiki>
|-
| [[:Sinn Féin]] || <nowiki>55207862X </nowiki>
|-
| [[:Statistical machine translation]] || <nowiki>0-12-36280-X </nowiki>
|-
| [[:Steamtown Peterborough Museum]] || <nowiki>978-1-84677-066-x </nowiki>
|-
| [[:Supermarine Spitfire]] || <nowiki>1-885605-702-X </nowiki>
|-
| [[:Supermarine Spitfire operational history]] || <nowiki>1-885605-702-X </nowiki>
|-
| [[:The Music Man]] || <nowiki>10-083718486X 1975 </nowiki>
|-
| [[:The Picture of Dorian Gray]] || <nowiki>978-0140433187-X </nowiki>
|-
| [[:White House]] || <nowiki>698-10546-X </nowiki>
|-
| [[:Women's rights]] || <nowiki>978019280510X </nowiki>
|}
=== ISBN wrong syntax (AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Ernest Hemingway]] || <nowiki>-10 </nowiki>
|-
| [[:Esam Omeish]] || <nowiki>-10 </nowiki>
|-
| [[:Esam Omeish]] || <nowiki>-13 </nowiki>
|-
| [[:George Henry Walton]] || <nowiki>-10 </nowiki>
|-
| [[:Human-readable medium]] || <nowiki>-13 </nowiki>
|-
| [[:Machine-readable]] || <nowiki>-13 </nowiki>
|-
| [[:Machine-readable medium]] || <nowiki>-13 </nowiki>
|-
| [[:Sankofa]] || <nowiki>-10 </nowiki>
|-
| [[:Scott L. McGregor]] || <nowiki>-13 </nowiki>
|-
| [[:Sodium chlorite]] || <nowiki>-13 </nowiki>
|-
| [[:Sonia Gandhi]] || <nowiki>-13 </nowiki>
|-
| [[:Stochastic oscillator]] || <nowiki>-10 </nowiki>
|-
| [[:Takeda Sōkaku]] || <nowiki>-13 </nowiki>
|-
| [[:The Third Man]] || <nowiki>-13 </nowiki>
|-
| [[:Third World]] || <nowiki>-10 </nowiki>
|-
| [[:Tibetan Buddhism]] || <nowiki>-13 </nowiki>
|-
| [[:Time Warner Center]] || <nowiki>-10 </nowiki>
|-
| [[:Timur]] || <nowiki>-13 </nowiki>
|-
| [[:Touching Spirit Bear]] || <nowiki>-10 </nowiki>
|-
| [[:TSL]] || <nowiki>-13 </nowiki>
|}
=== Math not correct end ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Camilo villamizar]] || <nowiki><math></nowiki>
|}
=== Reference duplication (partial AWB) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Eastern Air Lines]] || <nowiki><ref>'Rickenbacker' by Edward V. Rickenbacker, Prentice-Hall 1967</ref> </nowiki>
|-
| [[:Jacqueline Bracamontes]] || <nowiki><ref>[http://www.novebox.com/telepedia/star/jacqueline-bracamontes-0]</ref> </nowiki>
|-
| [[:Jim McCormick (speaker)]] || <nowiki><ref>[http://www.takerisks.com/about-motivational-speaking.html] www.takerisks.com ''About Jim McCormick'' Accessed January 15, 2010</ref> </nowiki>
|-
| [[:Joseph Wright of Derby]] || <nowiki><ref>{{cite web | title = Joseph Wright of Derby Biograph | url = http://www.mezzo-mondo.com/arts/mm/wright/wright.html | accessdate = 2007-12-01 }}</ref> </nowiki>
|-
| [[:Kisangani]] || <nowiki><ref>Sources : Wikipedia 2007, Monuc 2006 et Guy De Boeck</ref> </nowiki>
|-
| [[:Koonya (1887)]] || <nowiki><ref>[http://newspapers.nla.gov.au/ndp/del/article/9133752?searchTerm=Koonya The Mercury Saturday 7 May 1887]</ref> </nowiki>
|-
| [[:LEAF Award]] || <nowiki><ref>{{citeweb|url=http://www.ameinfo.com/81606.html|title=LEAF Awards 2006 call for entries announced|publisher=AMEinfo|accessdate=2009-09-15}}</ref> </nowiki>
|-
| [[:List of Slayers characters]] || <nowiki><ref>"Sudden Cooking! Return of the Phantom Dragon!"</ref> </nowiki>
|-
| [[:Local currency]] || <nowiki><ref>[http://news.bbc.co.uk/1/hi/magazine/8245276.stm]</ref> </nowiki>
|-
| [[:Millicom]] || <nowiki><ref>[http://files.shareholder.com/downloads/MICC/797108140x0x334090/9E562FB6-C62D-483F-BEE1-7C75E25BBF3F/091126_Cambodia_closing.pdf]</ref> </nowiki>
|-
| [[:Narara (1900)]] || <nowiki><ref>[http://newspapers.nla.gov.au/ndp/del/article/15062145?searchTerm=Narara The Sydney Morning Herald Monday 31 May 1909]</ref> </nowiki>
|-
| [[:PL/I]] || <nowiki><ref>ANS Programming Language PL/I. X3.53-1976,</ref> </nowiki>
|-
| [[:Richard Lee (activist)]] || <nowiki><ref>[http://www.voanews.com/english/2009-11-11-voa1.cfm Voice of America News, November 11, 2009]</ref> </nowiki>
|-
| [[:Scatterheart]] || <nowiki><ref>Stein, J. & Urdang, L. (eds) ''Random house dictionary of the English language. ''New York: Random House.</ref> </nowiki>
|-
| [[:Steve Jameson]] || <nowiki><ref>http://www.cedarartstudio.com/</ref> </nowiki>
|-
| [[:Tassili Airlines]] || <nowiki><ref>[http://www.aerocontact.com/actualite_aeronautique_spatiale/ac-tassili-airlines-va-acquerir-sept-appareils-aupres-de-boeing-et-embrae~08485.html]</ref> </nowiki>
|-
| [[:The 4th Dimension Movie]] || <nowiki><ref>http://www.tlareleasing.com/details/product_details.cfm?id=229595</ref> </nowiki>
|-
| [[:Toledo Nanochess]] || <nowiki><ref>[http://nanochess.110mb.com/chess3.html]</ref> </nowiki>
|-
| [[:Uranium hydride]] || <nowiki><ref>http://books.google.com/books?id=u0ZdEdgLlP0C&pg=PA789&dq=%22uranium+hydride%22&lr=&num=50&as_brr=3&cd=24#v=onepage&q=%22uranium%20hydride%22&f=false</ref> </nowiki>
|-
| [[:Water privatization in Tanzania]] || <nowiki><ref> Greenhill, R. and Wekiya, I. (2004). [http://www.actionaid.org.uk/wps/content/documents/TurningofftheTAps.pdf Turning off the taps : donor conditionality and water privatisation in Dar es Salaam, Tanzania], London, UK, ActionAid, p. 2 </ref> </nowiki>
|-
| [[:Winter storms of 2009–2010]] || <nowiki><ref>{{cite news |url=http://news.bbc.co.uk/1/hi/world/americas/8405500.stm |title=Snow storm moves on but leaves much of US shivering |work=[[BBC News]] |publisher=[[BBC|British Broadcasting Corporation]] |date=10 December 2009 |accessdate=14 December 2009}}</ref> </nowiki>
|-
| [[:Winter storms of 2009–2010 in East Asia]] || <nowiki><ref>{{cite news|url=http://www.straitstimes.com/BreakingNews/Asia/Story/STIStory_473504.html|title=Big chill grips Asia|last=Breaking News|first=Reuters|date=January 4, 2010|work=Reuters|publisher=The Straits Times|accessdate=9 January 2010}}</ref> </nowiki>
|-
| [[:Xfinity]] || <nowiki><ref>[http://blog.comcast.com/2010/02/comcast-launches-xfinity.html]</ref> </nowiki>
|-
| [[:Zeno Sustac]] || <nowiki><ref>http://www.hg.org/article.asp?id=7945</ref> </nowiki>
|-
| [[:ZPHS Dharmaram]] || <nowiki><ref>http://sites.google.com/site/ddharmaramschools/home/students-information</ref> </nowiki>
|}
=== Section without content ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Cagayan de Oro City]] || <nowiki>== Gallery ==</nowiki>
|-
| [[:Hawk Mill, Shaw]] || <nowiki>===Later extensions===</nowiki>
|-
| [[:International football players with dual citizenship]] || <nowiki>==Cameroon==</nowiki>
|-
| [[:Karthik Calling Karthik]] || <nowiki>===Box Office===</nowiki>
|-
| [[:List of Japanese arcade cabinets]] || <nowiki>===Video Game===</nowiki>
|-
| [[:List of mammals of North America]] || <nowiki>===[[Noctilionidae]]===</nowiki>
|-
| [[:Millicom]] || <nowiki>== Former Operations ==</nowiki>
|-
| [[:Montreal AAA]] || <nowiki>==See also==</nowiki>
|-
| [[:National University of Ireland, Maynooth Drama Society]] || <nowiki>==History==</nowiki>
|-
| [[:Pattaya United F.C. season 2010]] || <nowiki>==Team kit==</nowiki>
|-
| [[:PL/I]] || <nowiki>===Hello world program===</nowiki>
|-
| [[:Poe: More Tales of Mystery and Imagination]] || <nowiki>==Stage Musical Version==</nowiki>
|-
| [[:Ponnekallu]] || <nowiki>== Geography ==</nowiki>
|-
| [[:Rammkommando "ELBE"]] || <nowiki>===Similarities with the Japanese kamikazes===</nowiki>
|-
| [[:Royal Thai Army F.C. season 2010]] || <nowiki>==Team kit==</nowiki>
|-
| [[:Royton Ring Mill, Royton]] || <nowiki>=== Equipment ===</nowiki>
|-
| [[:Samut Songkhram F.C. season 2010]] || <nowiki>==Team kit==</nowiki>
|-
| [[:Shazia Hidayat]] || <nowiki>== See also ==</nowiki>
|-
| [[:Shien's Revenge]] || <nowiki>==Links==</nowiki>
|-
| [[:Sisaket F.C. season 2010]] || <nowiki>==Team kit==</nowiki>
|-
| [[:South Division One (shinty)]] || <nowiki>==List of Winners==</nowiki>
|-
| [[:Telecommunications in Palestine]] || <nowiki>==PCs==</nowiki>
|-
| [[:The Wicked and the Dead]] || <nowiki>==Trivia==</nowiki>
|-
| [[:Thomas George (fighter)]] || <nowiki>==Personal life==</nowiki>
|-
| [[:~Collin's World~]] || <nowiki>==Plot==</nowiki>
|}
=== Square brackets not correct begin (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:An Amateur Laborer]] || <nowiki>an%20amateur%20laborer%22%20%22dreiser%22&f=false]]</nowiki>
|-
| [[:Beth Bachmann]] || <nowiki>[Blackbird (online journal)|[Blackbird]]</nowiki>
|-
| [[:Bwamiramira]] || <nowiki>Kibaale District Internet Portal]]</nowiki>
|-
| [[:Claude Hall]] || <nowiki>Handbook of Texas]]</nowiki>
|-
| [[:Condop]] || <nowiki>REAL ESTATE; 'CONDOP': A NEW EAST SIDE CONVERSION]]</nowiki>
|-
| [[:Cycling in Detroit]] || <nowiki>Michigan Department of Transportation maps]]</nowiki>
|-
| [[:Dawn Mill, Shaw]] || <nowiki>Mill, Shaw 0012.png|200px|Working in 1950]]</nowiki>
|-
| [[:Dick Crocker]] || <nowiki>1891| location = [ty[Newark, New Jersey|Newark]]</nowiki>
|-
| [[:Erroll Bennett]] || <nowiki>Soccer Star", ''[[Engisn (LDS magazine)]]|Ensign]]</nowiki>
|-
| [[:Fethard-on-Sea]] || <nowiki>Irish Times, June 30th 2009]]</nowiki>
|-
| [[:Gymnoi sto dromo]] || <nowiki>Gymnoi sto dromo]]</nowiki>
|-
| [[:Hermann Fol]] || <nowiki>Multimedia Presentation about Hermann Fol]]</nowiki>
|-
| [[:International football players with dual citizenship]] || <nowiki>Sulejmani]]</nowiki>
|-
| [[:Malayalam language]] || <nowiki>in [[Singapore]]|rank=29|familycolor=Dravidiaes]]</nowiki>
|-
| [[:Motorola Devour]] || <nowiki>[[Bluetooth#Bluetooth 2.1|Bluetooth 2.1+EDR]]]]</nowiki>
|-
| [[:Nick Sanza]] || <nowiki>Asiago]] (Serie A (ice hockey)|ITA]]</nowiki>
|-
| [[:Rexel]] || <nowiki>[[Puerto Rico]], [[Hungary]], [[Ireland]], and ]]</nowiki>
|-
| [[:South Division One (shinty)]] || <nowiki>Marine Harvest North Division One]]</nowiki>
|-
| [[:Sreemoolanagaram]] || <nowiki>a small town near to [[Aluva]]. It is in [Aluva]]</nowiki>
|-
| [[:Surprise Hotel]] || <nowiki>2009 | Format = [|7" vinyl on 11/16/09]]</nowiki>
|-
| [[:The Awesome Time]] || <nowiki>| image = | caption = The ''Awesome Time'']]</nowiki>
|-
| [[:The Babys (The Babys album)]] || <nowiki>"Laura" <small>([[J. Waite]]/[[W. Stocker]]/]]</nowiki>
|-
| [[:Tirupur]] || <nowiki>Ramanathapuram, Tirunelveli and Nagercoil]]</nowiki>
|-
| [[:Trent Mill, Shaw]] || <nowiki>steam engine#Corliss valves|Corliss valves]]]]</nowiki>
|-
| [[:Yingli Green Energy Holding Company.Ltd.]] || <nowiki>[[ingot]]s, wafers,[photovoltaic cells]]</nowiki>
|}
=== Square brackets not correct end (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Acadia]] || <nowiki>[[French and Indian War](7 Years War)] between Britain and France (the North America</nowiki>
|-
| [[:Aphanizomenon flos-aquae (dietary supplement)]] || <nowiki>[[Cyanobacteria]* [[Microphyte]]* [[Algaculture]]== References ==# Carmichael W.</nowiki>
|-
| [[:Brazilian blastomycosis]] || <nowiki>[[Category:Mycosis-related cutaneous conditions]</nowiki>
|-
| [[:Geoffrey S. Fletcher]] || <nowiki>[[4th Alliance of Women Film Journalists Award<ref>{{cite web |url=http://awfj.org/eda-awards/2009-eda-award-winners</nowiki>
|-
| [[:John B. Campbell]] || <nowiki>[[19th Infantry Regiment (United States) |19th infantry]. He was brevetted colone</nowiki>
|-
| [[:Kevin O'Dwyer Sculptor]] || <nowiki>[[Japanese Imperial Family. In 2001 he was commissioned to make the Jameson Shor</nowiki>
|-
| [[:List of Productions at The Mark Taper Forum]] || <nowiki>[[Luis Valdez]'''''Dusa, Fish, Stas & Vi''''' (American Premiere) by Pam Gems; Directe</nowiki>
|-
| [[:Lord Elliott Windsor]] || <nowiki>[[St Johns senior school in North London since he was four years old. However he</nowiki>
|-
| [[:Mallappally]] || <nowiki>[[St. Geevarghese Mar Dionysius of Vattasseril (Dionysius VI)]and Bishop Joseph Ma</nowiki>
|-
| [[:Mallappally]] || <nowiki>[[Thiruvalla] -14 km] / [[Changanassery]-14 km] /[(Chenganoor)- 16 km</nowiki>
|-
| [[:Mallappally]] || <nowiki>[[Changanassery]-14 km] /[(Chenganoor)- 16 km] and the nearest airport</nowiki>
|-
| [[:Mallappally]] || <nowiki>[[Cochin International Airport]-100 km] & [(Trivandrum International Airport)-125 km].'''Notabl</nowiki>
|-
| [[:Margot Hutcheson]] || <nowiki>[[http://www.ngv.vic.gov.au/collection/pub/artistItemListing?artistID=3818 Nationa</nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1913–1917]] || <nowiki>[[Canterbury by-election, 1914|resultant by-election was won by ALP candidate [[Georg</nowiki>
|-
| [[:Members of the New South Wales Legislative Assembly, 1917–1920]] || <nowiki>[[Macquarie by-election, 1917|resultant by-election was won by ALP candidate [[Patric</nowiki>
|-
| [[:Nerul]] || <nowiki>[[There is also Nerul Gymkhana with lots of facilities for sports.==External links==*[http://vtalk2.com</nowiki>
|-
| [[:Out From Under: Disability, History and Things to Remember]] || <nowiki>[[interpretive texts help confront [[stereotypical]] representations of disabilit</nowiki>
|-
| [[:Phoradendron pauciflorum]] || <nowiki>[[temperate coniferous forest|coniferous forests. This [[mistletoe]] is a [[parasiti</nowiki>
|-
| [[:Recurring Dream and Apocalypse of Darkness]] || <nowiki>[[Vinyl Record|LP]. The LP was available in two colors (orange and white) limite</nowiki>
|-
| [[:SHETRAN]] || <nowiki>[[Newcastle University], after the introduction of the sediment and solute transpor</nowiki>
|-
| [[:The Ancient Forest of Elves]] || <nowiki>[[Power metal]| Length = 13:44| Label = Limb Music Productions| Produce</nowiki>
|-
| [[:Tiger in Chinese culture]] || <nowiki>[[http://english.savechinastigers.org/</nowiki>
|-
| [[:U.S. 119th Infantry Regiment]] || <nowiki>[[United State Army National Guard as recently as 2000. ==References=='''Bibliography'''*"2n</nowiki>
|-
| [[:Utrecht School of Law Clinical Programme on Conflict, Human Rights and International Justice]] || <nowiki>[[Media:http://www.corteidh.or.cr/convenios/utrecht.pdf]http://www.corteidh.or.cr/convenios/utrecht.pdf</nowiki>
|-
| [[:Vyacheslav Bazylevych]] || <nowiki>[[http://www.ffu.org.ua/ukr/teams/teams_u1990/prof/20467/ Profile at Official FF</nowiki>
|}
=== Table not correct end ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Aaron Morris Actor]] || <nowiki> {|class="wikitable" style="font-size: 90%;" ;|- s… </nowiki>
|-
| [[:Azulon Dolmayan]] || <nowiki> {| class="wikitable" style="text-align:center;"|-… </nowiki>
|-
| [[:Cycling at the 2010 South Asian Games]] || <nowiki> {| class="wikitable"|- bgcolor="#efefef"| '''Med… </nowiki>
|-
| [[:Gian Sotto]] || <nowiki> {| border="2" cellpadding="4" cellspacing="0" styl… </nowiki>
|-
| [[:Juanna Sanghvi]] || <nowiki> {| class="wikitable"|-! header 1Heyy Babyy (2007… </nowiki>
|-
| [[:List of Superbowl winning quarterbacks]] || <nowiki> {| class="wikitable sortable"!width=3%|Game!widt… </nowiki>
|-
| [[:List of UK student political societies]] || <nowiki> {| class="wikitable"|-|colspan="9" |'''List of … </nowiki>
|-
| [[:Mark Butt]] || <nowiki> {| class="wikitable" width="400"! colspan="3" bgc… </nowiki>
|-
| [[:Marvel Ultimate Collections and Complete Epics]] || <nowiki> {|class="wikitable"!Title!Volume !Collects|-|… </nowiki>
|-
| [[:Marvin Humes]] || <nowiki> {|class="wikitable" border="2" cellpadding="4" bac… </nowiki>
|-
| [[:Mass interconnect]] || <nowiki> {| class="wikitable"|-|Mass interconnect system… </nowiki>
|-
| [[:Mercosur]] || <nowiki> {| style="float:right; background:transparent;" … </nowiki>
|-
| [[:Neighborhoods of Latur City]] || <nowiki> {|cellspacing=2|valign=top|* LIC Colony* Vishal… </nowiki>
|-
| [[:Nirnayam (1995 film)]] || <nowiki> {| border="2" cellpadding="4" cellspacing="0" styl… </nowiki>
|-
| [[:Ponnekallu]] || <nowiki> {| class="wikitable"|-! Years! Men! Women|-|… </nowiki>
|-
| [[:Randers Thornder]] || <nowiki> {| class="toccolours" style="text-align: left;"-… </nowiki>
|-
| [[:Rangers F.C.]] || <nowiki> {| class="navbox"{{Rangers F.C.|state=uncollapsed… </nowiki>
|-
| [[:Soulbook tour]] || <nowiki> {| class="wikitable"|- bgcolor="#CCCCCC"! width=… </nowiki>
|-
| [[:St Ives Town F.C.]] || <nowiki> {| class="wikitable"{| border="1" cellpadding="1"… </nowiki>
|-
| [[:Tear Fund Gospel Tour]] || <nowiki> {| class="wikitable"|- bgcolor="#DDDDDD"|- bgcol… </nowiki>
|-
| [[:The Gold Tour]] || <nowiki> {| class="wikitable"|- bgcolor="#CCCCCC"! width=… </nowiki>
|-
| [[:The Sunny Cowgirls]] || <nowiki> {| class=wikitable|-! Year! Single! Album|-|… </nowiki>
|-
| [[:Thomas George (fighter)]] || <nowiki> {| style='font-size: 85%; text-align: left;' class… </nowiki>
|-
| [[:Weighlifting at the 2010 South asian games]] || <nowiki> {| class="wikitable"|- bgcolor="#efefef"| '''Med… </nowiki>
|-
| [[:When darkness falls]] || <nowiki> {| class="wikitable"… </nowiki>
|}
=== Template not correct begin (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2005 in South Korean football]] || <nowiki>'''[[Auckland City FC|Auckland City]]'''|'''3'''}}</nowiki>
|-
| [[:Amal Arafa]] || <nowiki>Amal with her family]((catneeded}}</nowiki>
|-
| [[:Bad Romance]] || <nowiki>by [[Erik Grönwall]]<br />Incumbent}}}}</nowiki>
|-
| [[:Casualties of the 2010 Haiti earthquake]] || <nowiki>the earthquake.<ref name=eluniversal16>{sp icon}}</nowiki>
|-
| [[:Coral reef fishes]] || <nowiki>true eye, making it hard to see.<ref>[[FishBase]]}}</nowiki>
|-
| [[:David Gergen]] || <nowiki>Gergen Biography | accessdate = 2009-02-08 }}</nowiki>
|-
| [[:Goldenlaser Laser Metal marker]] || <nowiki>Not Enough (video game)|The World Is Not Enough}}</nowiki>
|-
| [[:It’s better to live]] || <nowiki>2010}} 2010}}</nowiki>
|-
| [[:John Arne Riise]] || <nowiki>newspaper|date=2008-06-19|accessdate=2008-06-19}}</nowiki>
|-
| [[:Ladywood]] || <nowiki>Ward|publisher=Birmingham City Council}}</nowiki>
|-
| [[:List of progressive metal artists]] || <nowiki>1991). "New Rage: The Funy". Guitar Player.}}</nowiki>
|-
| [[:Little miss perfect]] || <nowiki> = http://wetv.com/littlemissperfect}}}}</nowiki>
|-
| [[:Marcus Magna]] || <nowiki>0| club-update = 13:43, 25 October 2009 (UTC)]]}}</nowiki>
|-
| [[:Meadow Lake, Saskatchewan]] || <nowiki>| accessdate = 2009-09-06}}</ref>}}</nowiki>
|-
| [[:Nor Cal Red Hawks]] || <nowiki>= 2010|time = 12:57|timestamp = 20100201125706}}</nowiki>
|-
| [[:Scarlett Johansson]] || <nowiki>|date=2009-03-12}} |accessdate=2009-08-08}}</nowiki>
|-
| [[:Stronger with Each Tear]] || <nowiki>album|years=January 6, 2010 – }}</nowiki>
|-
| [[:Survivor 2010]] || <nowiki>form.lpsubmitorig2(); } } }}</nowiki>
|-
| [[:Survivor allstars 2]] || <nowiki>form.lpsubmitorig2(); } } }}</nowiki>
|-
| [[:Survivor heroes v villains]] || <nowiki>form.lpsubmitorig2(); } } }}</nowiki>
|-
| [[:Survivor heroes vs villains]] || <nowiki>form.lpsubmitorig2(); } } }}</nowiki>
|-
| [[:The John Holmes Book Club]] || <nowiki>2010}} 2010}}</nowiki>
|-
| [[:Uyghur people]] || <nowiki>({{zh|c=鐵勒|p=Tiělè|links=no}}; Turkic: Tele}}</nowiki>
|-
| [[:Whitecap Mountain]] || <nowiki>m/resortguide/overview.cfm/wi24/WhitecapMountains}}</nowiki>
|-
| [[:Wigglybus]] || <nowiki>[[Connect2Wiltshire]]{R from original name}}</nowiki>
|}
=== Template not correct end (AWB assisted, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1500 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1500 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1500 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1500 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1616 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1616 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1616 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1616 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1616 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:1625 Sheridan Road (Wilmette)]] || <nowiki>{{cite book |last1=Shea |first1=Robert | title=From No Man’s Land, To Plaza del</nowiki>
|-
| [[:Clara Paget]] || <nowiki>{{Infobox actor|name = Clara Paget|birthname = Clara Paget|birthdate = 1988|birthplace</nowiki>
|-
| [[:Graceland Academy]] || <nowiki>{{infobox| founder:{{New unreviewed article|source=ArticleWizard|date=February 2010}}'''New</nowiki>
|-
| [[:Hawk Mill, Shaw]] || <nowiki>{{DEFAULTSORT:Hawk Mill, Shaw[[Category:Textile mills owned by the Lancashire Cotton</nowiki>
|-
| [[:Jean-Louis Bory]] || <nowiki>{{ndash}[[Francois Nourissier]], [[Hervé Bazin]], [[Jean d'Ormesson]], [[Georges</nowiki>
|-
| [[:List of songs by Nick Jonas and the Administration]] || <nowiki>{{Navbox Musical artist| name = Nick Jonas and the Administration| title = [[Nick</nowiki>
|-
| [[:Nothin' to It (album)]] || <nowiki>{{cite web|url=http://www.allaboutjazz.com/php/article.php?id=31735|title=(((Nothin'</nowiki>
|-
| [[:Pinguicula elizabethiae]] || <nowiki>{{¼–⅜ in.) wide and generally obovate to suborbicular. The outer lower</nowiki>
|-
| [[:Riksvei 191]] || <nowiki>{{{{Infobox road|marker_image=|state=|highway_name=|name_notes=|type=[[riksvei]]|route=[[Trosterud]]</nowiki>
|-
| [[:Royton Ring Mill, Royton]] || <nowiki>{{DEFAULTSORT:{{Pagename}}[[Category:Textile mills owned by the Lancashire Cotton</nowiki>
|-
| [[:Speed skating at the 2002 Winter Olympics – Men's 1500 metres]] || <nowiki>{{sort|48|-} || 13 || align="left"| [[Christian Breuer]] || align="left"| {{FlagIOC|GER|2002</nowiki>
|-
| [[:Trey Lavely]] || <nowiki>{{infobox musical artist | Name </nowiki>
|-
| [[:Visa requirements for Chinese citizens of Hong Kong]] || <nowiki>{{no|Hong Kong SAR passport holders cannot enter People's Republic of China using</nowiki>
|-
| [[:Visa requirements for German citizens]] || <nowiki>{{yes|90 days|-! style="text-align: left;"|{{flagcountry|Mayotte}}|{{yes|90 days}}</nowiki>
|-
| [[:Visa requirements for German citizens]] || <nowiki>{{yes|30 days visa issued upon arrival (free of charge) |-! style="text-align: left;"|{{flag|Vanuatu}}|{{yes|30</nowiki>
|-
| [[:Xbox Portable]] || <nowiki>{{Infobox VG system|title= XBox Portable|logo=[[File:Xbox 360.svg|230px|Official</nowiki>
|}
=== Template parameter with problem ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:August Derleth]] || <nowiki>columns-list, ''Sac Prairie Saga''*''Still is the Summer Night'' (1937)*''Wind Over Wisconsin'' (1938)*''Any Day Now'' (1938)*''Restless is the River'' (1939)*''Evening in Spring'' (1941)*''Sweet Genevieve'' (1942)*''Shadow of Night'' (1943)*''The Shield of the Valiant'' (1945)*''The House of Moonlight'' (1953)'''Other'''*''Murder Stalks the Wakely Family'' (1934)*''The Man on All Fours'' (1934)*''Three Who Died'' (1935)*''Sign of Fear'' (1935)*''Sentence Deferred'' (1939)*''The Narracong Riddle'' (1940)*''Bright Journey'' (1940)*''The Seven Who Waited'' (1943)*''Mischief in the Lane'' (1944)*''No Future for Luana'' (1945)*''Oliver, The Wayward Owl'' (1945)*''The Country of the Hawk'' (1952)*''The Captive Island'' (1952)*''Fell Purpose'' (1953)*''Death by Design'' (1953)*''Empire of Fur'' (1953)*''Land of Gray Gold'' (1954)*''Land of Sky Blue Waters'' (1955)*''The House on the Mound'' (1958)*''The Moon Tenders'' (1958)*''Wilbur, The Trusting Whippoorwill'' (1959)*''The Mill Creek Irregulars'' (1959)*''The Hills Stand Watch'' (1960)*''The Pinkertons Ride Again'' (1960)*''The Ghost of Black Hawk Island'' (1961)*''Sweet Land of Michigan'' (1962)*''The Tent Show Summer'' (1963)*''The Beast in Holger's Woods'' (1968)*''The Prince Goes West'' (1968)</nowiki>
|-
| [[:Dawn Mill, Shaw]] || <nowiki>Infobox Mill building, P.S. Stott]]| 1901 || 2006 | caption</nowiki>
|-
| [[:Denis Leary]] || <nowiki>Infobox Comedian, U.S.]]| medium</nowiki>
|-
| [[:Dublin GAA]] || <nowiki>GAA squad player, John Cooke]]|club</nowiki>
|-
| [[:Gotta Get It (song)]] || <nowiki>Infobox Single, T. Gray]]| Producer</nowiki>
|-
| [[:Hands On You]] || <nowiki>Infobox Single, M. Cooper]]| Producer</nowiki>
|-
| [[:Howcast]] || <nowiki>Infobox Dotcom company, Howcast logo]]| company_type</nowiki>
|-
| [[:James "Sawyer" Ford]] || <nowiki>Infobox Lost character, *Total Centric Episodes: 6. Name</nowiki>
|-
| [[:Jesse Jane]] || <nowiki>Female adult bio, Hazel]]| hair color</nowiki>
|-
| [[:Malayalam language]] || <nowiki>Infobox Language, A bilingual Malayalam and English sign board]] |map</nowiki>
|-
| [[:Mile Jedinak]] || <nowiki>Infobox Football biography 2, ]]| clubnumber</nowiki>
|-
| [[:Nakheel Properties]] || <nowiki>Infobox Company, 100px]] || vector_logo</nowiki>
|-
| [[:Page Hamilton]] || <nowiki>Infobox musical artist, Heavy metal]]| Occupation</nowiki>
|-
| [[:Petroplus]] || <nowiki>Infobox Company, Oil and gas]] | products</nowiki>
|-
| [[:Prince (musician)]] || <nowiki>Infobox musical artist, Universal]]|Associated_acts</nowiki>
|-
| [[:R&J Stone]] || <nowiki>Infobox musical artist, USA]]| Instrument</nowiki>
|-
| [[:Rahul Sankrityayan]] || <nowiki>quotation, '''Novels'''*''Baisvin Sadi'' - 1923*''Jine ke Liye'' - 1940*''Simha Senapathi'' - 1944*''Jai Yaudheya'' - 1944*''Bhago Nahin, Duniya ko Badlo'' - 1944*''Madhur Svapna'' - 1949*''Rajasthani Ranivas'' - 1953*''Vismrit Yatri'' - 1954*''Divodas'' - 1960*''Vismriti Ke Garbh Me'''''Short Stories'''*''Satmi ke Bachche'' - 1935*''Volga Se Ganga'' - 1944*''Bahurangi Madhupuri'' - 1953*''Kanaila ki Katha'' - 1955-56'''Autobiography'''*''Meri Jivan Yatra I'' - 1944*''Meri Jivan Yatra II'' - 1950*''Meri Jivan Yatra III, IV, V'' - published posthumously'''Biography'''*''Sardar Prithvi Singh'' - 1955*''Naye Bharat ke Naye Neta (2 volumes)'' - 1942*''Bachpan ki Smritiyan'' - 1953*''Atit se Vartaman (Vol I)'' - 1953*''Stalin'' - 1954*''Lenin'' - 1954*''Karl Marx'' - 1954*''Mao-Tse-Tung'' - 1954*''Ghumakkar Swami'' - 1956*''Mere Asahayog ke Sathi'' - 1956*''Jinka Main Kritajna'' - 1956*''Vir Chandrasingh Garhwali'' - 1956*''Simhala Ghumakkar Jaivardhan'' - 1960*''Kaptan Lal'' - 1961*''Simhal ke Vir Purush'' - 1961*''Mahamanav Budha'' - 1956'''Some of his other books are''':-*''Mansik Gulami''*''Rhigvedic Arya''*''Ghumakkar Shastra''*''Kinnar desh mein''*''Darshan Digdarshan''*''Dakkhini Hindi ka Vyaakaran'' *''Puratatv Nibandhawali''*''Manava Samaj''</nowiki>
|-
| [[:Rolls-Royce Merlin]] || <nowiki>#tag:ref, Factory production numbers:* Rolls-Royce: Derby</nowiki>
|-
| [[:Shawn Lalonde]] || <nowiki>Infobox Ice Hockey Player, OHL]]| team</nowiki>
|-
| [[:Shibu Soren]] || <nowiki>Infobox Indian politician, Dumka]]| salary</nowiki>
|-
| [[:Slovaks]] || <nowiki>Infobox Ethnic group, Slovak]]|rels</nowiki>
|-
| [[:Steven Tyler]] || <nowiki>Infobox musical artist, US]]| Died</nowiki>
|-
| [[:Trent Mill, Shaw]] || <nowiki>Infobox Mill building, Spinning (ring mill)]]| architectural_style</nowiki>
|-
| [[:Union Buildings]] || <nowiki>Infobox Historic building, thumb]]|caption</nowiki>
|-
| [[:Wheelers Hill Vipers]] || <nowiki>Infobox football club, Vipers logo]]| fullname</nowiki>
|}
=== Template programming element ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010 Michigan Wolverines football team]] || <nowiki>{{NAMESPACE}}|{{ns:10}} </nowiki>
|-
| [[:American Football League (1926)]] || <nowiki>{{{title|{{PAGENAME}}}}} </nowiki>
|-
| [[:Brand New Eyes]] || <nowiki>{{{Brand New Eyes > Overview}}}|publisher=Allmusic|author=Andrew </nowiki>
|-
| [[:Christopher Jefferies]] || <nowiki>{{NAMESPACE}}||[[Category:Pages with incorrectly substituted </nowiki>
|-
| [[:Cousin marriage]] || <nowiki>{{{align|right}}}|{{{size|350px}}}| </nowiki>
|-
| [[:Demographics of Argentina]] || <nowiki>#if:Image:Pyramide Argentine.PNG|<tr><td colspan="2" </nowiki>
|-
| [[:Eusko Trenbideak - Ferrocarriles Vascos]] || <nowiki>{{{class|}}}|class="{{{class}}}"| }} style="margin: </nowiki>
|-
| [[:Financial crisis]] || <nowiki>#if:the 2008–2010 crisis|the 2008–2010 crisis|other </nowiki>
|-
| [[:Hollywood Boulevard]] || <nowiki>{{{3|Hollywood Boulevard (disambiguation)}}}]].}} </nowiki>
|-
| [[:Hummelstown, Pennsylvania]] || <nowiki>{{{1|autocollapse}}}</includeonly><noinclude>expanded</noinclude </nowiki>
|-
| [[:John Squire]] || <nowiki>{{{ Second Coming > Review }}}]</ref> The album was </nowiki>
|-
| [[:Kalākaua]] || <nowiki>{{{cite web |author= Darlene E. Kelley |title= Kalakaua </nowiki>
|-
| [[:Kurnell Desalination Plant]] || <nowiki>{{{cost offsets|}}} </nowiki>
|-
| [[:Lawrence Garfinkel]] || <nowiki>#if:Garfinkel, Lawrence|{{DEFAULTSORT:Garfinkel, Lawrence}}} </nowiki>
|-
| [[:Liepāja]] || <nowiki>#if:[[Uldis Sesks]]|[[Mayor]]}} </nowiki>
|-
| [[:List of colors]] || <nowiki>{{{Verify credibility|date=March 2009}}}|a|e}}y]]} </nowiki>
|-
| [[:New South Wales state election, 1930]] || <nowiki>{{{state|uncollapsed}}} </nowiki>
|-
| [[:New South Wales state election, 1932]] || <nowiki>{{{state|uncollapsed}}} </nowiki>
|-
| [[:Oasis (band)]] || <nowiki>{{{ Standing on the Shoulders of Giants > Overview </nowiki>
|-
| [[:Oconee County Regional Airport]] || <nowiki>{{{sp}}}|us|er|re}}|d=LoffAoffDbSoff|s=}} west of [[Clemson, </nowiki>
|-
| [[:Riksvei 191]] || <nowiki>{{{{Infobox road </nowiki>
|-
| [[:Scientology in Germany]] || <nowiki>{{{1|Special:Search/Scientology in Germany|Wikisource] </nowiki>
|-
| [[:Topeka, Kansas]] || <nowiki>{{{sp}}}|us|er|re}}|d=LoffAoffDbSoff|s=}} in January </nowiki>
|-
| [[:Water supply and sanitation in Pakistan]] || <nowiki>{{{Image:Flag of Pakistan.svg|border|300px}}}|<tr><td </nowiki>
|-
| [[:Wendy Doniger]] || <nowiki>{{{titlestyle|background:#ddf;}}} </nowiki>
|}
=== Template with Unicode control characters (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Collège du Saint-Esprit]] || <nowiki>| motto = Ignis Vibrante Lumine| established = [[1938]]|</nowiki>
|-
| [[:Dunmaglass, Scotland]] || <nowiki>|imagesize = 256px|caption = Dunmaglass Lodge|rector </nowiki>
|-
| [[:Endsongs]] || <nowiki> | Alt = | Released = 2000| Recorded = 1999| Genre = [[Indie</nowiki>
|-
| [[:Imperfect(album)]] || <nowiki> | imagesize = | image_caption = Jaffna Public Library| image_flag = | flag_size</nowiki>
|-
| [[:List of current Maraji]] || <nowiki>}}</nowiki>
|-
| [[:List of current Maraji]] || <nowiki>}}</nowiki>
|-
| [[:List of current Maraji]] || <nowiki> }}</nowiki>
|-
| [[:List of current Maraji]] || <nowiki> }}</nowiki>
|-
| [[:Local Ghost Haunts]] || <nowiki>]]| caption = Title screenshot of the series.| show_name_2 </nowiki>
|-
| [[:Martin Deakin]] || <nowiki> | caption = Image From Myspace| birth_date = {{Birth date|1996|9|20|mf=y}}|</nowiki>
|-
| [[:Mazda Kiyora]] || <nowiki>|255px]]| name = Kiyora| manufacturer = Mazda| class = [[Concept</nowiki>
|-
| [[:Memorama (album)]] || <nowiki> | Released = 2008 | Recorded = | Genre = [[Power pop]], [[pop punk]]|</nowiki>
|-
| [[:Miracle in Seville (novel)]] || <nowiki>|175px]]| image_caption = 1st edition cover| author = [[James Michener]]|</nowiki>
|-
| [[:Morozova, Maria]] || <nowiki>| birth_place = [[Leningrad, Russia]]| nationality = [[Russian]]| occupation </nowiki>
|-
| [[:Palestine EP]] || <nowiki>| Recorded = 2008| Released = March 15, 2010| Label = [[Ici D'Ailleurs]]|</nowiki>
|-
| [[:Peace in the Valley (EP)]] || <nowiki>| Released = April 1957| Recorded = January 1957| Genre = [[Gospel</nowiki>
|-
| [[:Peter Batey]] || <nowiki>| imagesize=180px| birth_date= June 1, 1958| occupation= Chairman of [[Vermilion</nowiki>
|-
| [[:Private (One Chance album)]] || <nowiki> |Released = 2006 |Recorded = 2005-2006|Genre = [[Contemporary R&B|R&B]] |Length</nowiki>
|-
| [[:Sheikh Ja'afar Mahmud Adam]] || <nowiki> | image_caption = Sheikh Ja'afar Mahmud Adam| name = '''Sheikh</nowiki>
|-
| [[:Stanley Dufresne]] || <nowiki>|alt=Weird..|caption=More Weird..|birth_date=02/29/80|birth_place=[[Port-au-Prince]],</nowiki>
|-
| [[:Suat Suna]] || <nowiki> | Img_capt = | Img_size = 450| Background = solo_singer|</nowiki>
|-
| [[:Turn Ons]] || <nowiki>| Alt = | Released = 25 January 2010| Recorded = | Genre =</nowiki>
|-
| [[:Uma gaita na bossa]] || <nowiki> | Released = 1997| Recorded = | Genre = [[bossa nova]], [[jazz]]|</nowiki>
|-
| [[:Vito Nikolić]] || <nowiki>| imagesize = 200px| caption = | pseudonym = | birthdate = {{birth date|1934|04|27|mf=y}}|</nowiki>
|-
| [[:What's Your Favorite Color?: Remixes, B-Sides and Rarities]] || <nowiki> | Alt = | Released = April 5, 2005| Recorded = | Genre =</nowiki>
|}
== Middle Priority ==
=== Headline double ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1886 American Cup]] || <nowiki>===replay===</nowiki>
|-
| [[:2009–10 Kuwaiti Premier League]] || <nowiki>===Round 6===</nowiki>
|-
| [[:Adriaan van Dis]] || <nowiki>== Bibliography ==</nowiki>
|-
| [[:Alan Osório da Costa Silva]] || <nowiki>==External links==</nowiki>
|-
| [[:Arabinoxylan]] || <nowiki>==Functions==</nowiki>
|-
| [[:Benjamin O. Davis, Jr.]] || <nowiki>==References==</nowiki>
|-
| [[:Central Europe]] || <nowiki>==References==</nowiki>
|-
| [[:Dihydroxynaphthoquinone]] || <nowiki>===From 1,4-naphthoquinone===</nowiki>
|-
| [[:Fariba Ahmadi Kakar]] || <nowiki>==References==</nowiki>
|-
| [[:Garza (surname)]] || <nowiki>=== People ===</nowiki>
|-
| [[:H. D. L. Abraham]] || <nowiki>==References==</nowiki>
|-
| [[:Honda D engine]] || <nowiki>====D15B====</nowiki>
|-
| [[:Hydroxynaphthoquinone]] || <nowiki>===From 1,4-naphthoquinone===</nowiki>
|-
| [[:Ignác Goldziher]] || <nowiki>==References==</nowiki>
|-
| [[:Ilkhanate]] || <nowiki>=== House of Hulegu ===</nowiki>
|-
| [[:Indore Junction BG]] || <nowiki>== See also ==</nowiki>
|-
| [[:Men's CEV Cup 2009–10]] || <nowiki>===1/8 Finals===</nowiki>
|-
| [[:Mohammad Gul (Helmand Council)]] || <nowiki>==References==</nowiki>
|-
| [[:Phil Micech]] || <nowiki>==Biography==</nowiki>
|-
| [[:Shakiba]] || <nowiki>==References==</nowiki>
|-
| [[:Sophie Monk]] || <nowiki>=== Television ===</nowiki>
|-
| [[:Torah]] || <nowiki>==References==</nowiki>
|-
| [[:Turner Suspension Bicycles]] || <nowiki>===2008===</nowiki>
|-
| [[:VI Queen Elisabeth Music Competition]] || <nowiki>==References==</nowiki>
|-
| [[:Wind power in the United Kingdom]] || <nowiki>==Cost of back up to wind power in the UK==</nowiki>
|}
=== Category duplication (partial AWB, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:All I Do Is Win]] || <nowiki>Rappers templates</nowiki>
|-
| [[:Augusta Southern Professional Hockey League team]] || <nowiki>Southern Professional Hockey League teams</nowiki>
|-
| [[:Augusta Southern Professional Hockey League team]] || <nowiki>Ice hockey teams in Georgia (U.S. state)</nowiki>
|-
| [[:Craig Campbell (BMX rider)]] || <nowiki>Living people</nowiki>
|-
| [[:Duncanville High School Notable Alumni]] || <nowiki>People from Dallas County, Texas</nowiki>
|-
| [[:Elliott Lynch]] || <nowiki>American architects</nowiki>
|-
| [[:NetSim]] || <nowiki>Computer network analysis</nowiki>
|-
| [[:The Spirit of Islam]] || <nowiki>Muslim scholars</nowiki>
|-
| [[:Timothy McDarrah]] || <nowiki>Prisoners and detainees of the United States federal government</nowiki>
|-
| [[:Troublesome Night 11]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 12]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 13]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 14]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 15]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 16]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 5]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 6]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 7]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 8]] || <nowiki>Hong Kong horror films</nowiki>
|-
| [[:Troublesome Night 9]] || <nowiki>Hong Kong horror films</nowiki>
|}
=== DEFAULTSORT with special characters (AWB, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Antoine de Loménie]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Loménie, Antoine de </nowiki>
|-
| [[:Antoine Frérot]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Frérot, Antoine</nowiki>
|-
| [[:Óláfr Leggsson]] || <nowiki>á</nowiki> || <nowiki>DEFAULTSORT:Leggsson, Óláfr</nowiki>
|-
| [[:Bjørn Johan Muri]] || <nowiki>ø</nowiki> || <nowiki>DEFAULTSORT:Muri, Bjørn Johan</nowiki>
|-
| [[:Carlos Patiño]] || <nowiki>ñ</nowiki> || <nowiki>DEFAULTSORT:Patiño, Carlos</nowiki>
|-
| [[:Cuthbert Cary-Elwes]] || <nowiki>|</nowiki> || <nowiki>DEFAULTSORT:Cary-Elwes|Cuthbert</nowiki>
|-
| [[:Florimond II Robertet, seigneur de Fresnes]] || <nowiki></nowiki> || <nowiki>DEFAULTSORT:Alluye, Florimond III Robertet d’</nowiki>
|-
| [[:Florimond III Robertet d’Alluye]] || <nowiki></nowiki> || <nowiki>DEFAULTSORT:Alluye, Florimond III Robertet d’</nowiki>
|-
| [[:François Dominique de Barberie de Saint-Contest]] || <nowiki>ç</nowiki> || <nowiki>DEFAULTSORT:Saint-Contest, François Dominique de Barberie de </nowiki>
|-
| [[:Gilla in Chomded húa Cormaic]] || <nowiki>ú</nowiki> || <nowiki>DEFAULTSORT:Gilla in Chomded húa Cormaic</nowiki>
|-
| [[:Giolla Brighde Ó hEoghusa]] || <nowiki></nowiki> || <nowiki>DEFAULTSORT:Ó hEoghusa, Giolla Brighde</nowiki>
|-
| [[:Hawk Mill, Shaw]] || <nowiki>[[|]][[|]][[]</nowiki> || <nowiki>DEFAULTSORT:Hawk Mill, Shaw[[Category:Textile mills owned by the Lancashire Cotton</nowiki>
|-
| [[:Henryk Trębicki]] || <nowiki>ę</nowiki> || <nowiki>DEFAULTSORT:Trębicki, Henryk</nowiki>
|-
| [[:Ionuţ Costache]] || <nowiki>ţ</nowiki> || <nowiki>DEFAULTSORT:Costache, Ionuţ</nowiki>
|-
| [[:Javier Fabián Toledo]] || <nowiki>á</nowiki> || <nowiki>DEFAULTSORT:Toledo, Javier Fabián</nowiki>
|-
| [[:Jóan Símun Edmundsson]] || <nowiki>óí</nowiki> || <nowiki>DEFAULTSORT:Edmundsson, Jóan Símun</nowiki>
|-
| [[:Jean de Bonmarché]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Bonmarché, Jean de</nowiki>
|-
| [[:João Pedro Pinto Martins]] || <nowiki>ã</nowiki> || <nowiki>DEFAULTSORT:Martins,João</nowiki>
|-
| [[:Michal Pančík]] || <nowiki>čí</nowiki> || <nowiki>DEFAULTSORT:Pančík, Michal</nowiki>
|-
| [[:René Casados]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Casados, René</nowiki>
|-
| [[:Royton Ring Mill, Royton]] || <nowiki>{{</nowiki> || <nowiki>DEFAULTSORT:{{Pagename</nowiki>
|-
| [[:Seaán Ó Clumháin]] || <nowiki>áá</nowiki> || <nowiki>DEFAULTSORT:Ó Clumháin, Seaán</nowiki>
|-
| [[:Stella Heiß]] || <nowiki>ß</nowiki> || <nowiki>DEFAULTSORT:Heiß, Stella</nowiki>
|-
| [[:Stephanie Bouvier]] || <nowiki>é</nowiki> || <nowiki>DEFAULTSORT:Bouvier, Stéphanie</nowiki>
|-
| [[:Sufyan ibn `Uyaynah]] || <nowiki>`</nowiki> || <nowiki>DEFAULTSORT:`Uyaynah, Sufyan Ibn</nowiki>
|}
=== External link with line break ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alabuga River]] || <nowiki>[http://www.welcome.kg/ru/kyrgyzstan/nature/wot/168.html HydrologicalCharacteristics </nowiki>
|-
| [[:BMMI]] || <nowiki>[http://www.ameinfo.com/173598.html "Think Pink Charity Golf Day successful"] </nowiki>
|-
| [[:Bowdoin College]] || <nowiki>[http://bcn.bowdoin.edu}</ref>===A Capella===The [[Meddiebempsters] </nowiki>
|-
| [[:Chauncey Bangs]] || <nowiki>[http://www.sports-reference.com/olympics/athletes/ba/chauncy-bangs-1.html Sports-Reference.com{{NavigationCanadianChampionsFigureSkatingPairs}}{{NavigationNorthAmericanChampionsFigureSkatingPairs}}{{DEFAULTSORT:Bangs, </nowiki>
|-
| [[:Ciera Payton]] || <nowiki>[http://theater.nytimes.com/2009/11/12/theater/reviews/12savannah.htmlWebster, </nowiki>
|-
| [[:Clayson Queiroz]] || <nowiki>[http://www.cbf.com.br/bid/ti2006.htm Transferências Internacionais - CBF.com] </nowiki>
|-
| [[:Dalmore House and Estate]] || <nowiki>[http://canmore.rcahms.gov.uk/en/site/202665/details/dalmore+house/RCAHMS Dalmore </nowiki>
|-
| [[:Dirck Ferreris]] || <nowiki>[http://www.dbnl.org/tekst/houb005groo01_01/houb005groo01_01_0367.htm DirkFreres </nowiki>
|-
| [[:Economic Theory (Journal)]] || <nowiki>[http://www.springerlink.com/content/0938-2259</ref>== References =={{reflist}}== </nowiki>
|-
| [[:Elliott Lynch]] || <nowiki>[http://www.booktown.com/stcroixprints/plan.php?id=4552 | “August 1902, published </nowiki>
|-
| [[:History of Detroit, Michigan]] || <nowiki>[http://www.theworldiscoming.com/seethechange.html The world is coming see the change </nowiki>
|-
| [[:Isaac E. Ditmars]] || <nowiki>[http://faculty.plattsburgh.edu/kevin.decker/Research%20Information/Ditmars.htm | </nowiki>
|-
| [[:J. William Schickel]] || <nowiki>[http://eng.archinform.net/arch/48888.htm | archINFORM </ref>In 1885, he formed </nowiki>
|-
| [[:Juvenilia Press]] || <nowiki>[http://www2.arts.unsw.edu.au/juvenilia/index.htm/ Juvenilia Press homepage [[Category:Book </nowiki>
|-
| [[:Lindsay Vickery]] || <nowiki>[http://www.resonatemagazine.com.au/journal.php Source 4] </nowiki>
|-
| [[:List of the largest airports in the Nordic countries]] || <nowiki>[http://www.slv.dk Statens Luftfartsvæsen, Danish Civil Aviation Authority] </nowiki>
|-
| [[:Miss Venezuela 2010]] || <nowiki>[http://www.entornointeligente.com/resumen/resumen.php?items=1004139 La vida de Sarcos </nowiki>
|-
| [[:Myitsone Dam]] || <nowiki>[http://www.fiu.edu/~envstud/courses/evr5320/Graf_1999.pdf'' Dam nation: A geographic </nowiki>
|-
| [[:Saifee Villa]] || <nowiki>[http://cache.virtualtourist.com/2964834-Egyptian_Museum-Cairo.jpg Picture taken </nowiki>
|-
| [[:Schickel & Ditmars]] || <nowiki>[http://faculty.plattsburgh.edu/kevin.decker/Research%20Information/Schickel.htm </nowiki>
|-
| [[:The Good Guy (film)]] || <nowiki>[http://www.youtube.com/watch?v=_U4Gn2wJKZM&feature=player_embedded</ref>| released </nowiki>
|-
| [[:The Spirit of Islam]] || <nowiki>[http://ia311209.us.archive.org//load_djvu_applet.php?<br />4. The Spirit of Islam, </nowiki>
|-
| [[:Variations of red]] || <nowiki>[http://web.forret.com/tools/color.asp?RGB=%23E62020 web.forret.com Color Conversion </nowiki>
|-
| [[:Winston "Flames" Jarrett]] || <nowiki>[http://en.wikipedia.org/wiki/Alton_Ellis The Flames did a number of early classics </nowiki>
|-
| [[:Winter storms of 2009–2010]] || <nowiki>[http://www.cbc.ca/canada/story/2010/01/04/storm-maritimes.html] </nowiki>
|}
=== External link with two brackets (AWB, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Winter storms of 2009–2010]] || <nowiki>[[http://news.xinhuanet.com/english/2010-01/04/content_12752746.htm]] </nowiki>
|-
| [[:Winter storms of 2009–2010 in East Asia]] || <nowiki>[[http://news.xinhuanet.com/english/2010-01/04/content_12752746.htm]] </nowiki>
|}
=== Headline hierarchy (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Big Snowy Group]] || <nowiki>==Lithology==</nowiki><br /><nowiki>====Subdivisions====</nowiki>
|-
| [[:Brazilian Jiu-Jitsu]] || <nowiki>=== Primary Ground Positions ===</nowiki><br /><nowiki>=====[[Side Control]]=====</nowiki>
|-
| [[:Christian Stephen]] || <nowiki>== Discography ==</nowiki><br /><nowiki>==== Álbums ====</nowiki>
|-
| [[:Circumcision]] || <nowiki>==Policies of various national medical associations==</nowiki><br /><nowiki>====Australasia====</nowiki>
|-
| [[:Field Music (Measure)]] || <nowiki>==Track listing==</nowiki><br /><nowiki>====Disc one====</nowiki>
|-
| [[:Ismaily]] || <nowiki>==Current squad==</nowiki><br /><nowiki>====Out on loan====</nowiki>
|-
| [[:Jacmel Airport]] || <nowiki>== Airlines and destinations ==</nowiki><br /><nowiki>===== Airlines operating to and from Jacmel (domestic only) =====</nowiki>
|-
| [[:List of causes of unexplained weight loss]] || <nowiki>==Neurological diseases causing weight loss==</nowiki><br /><nowiki>====Renal causes of unexplained weight loss====</nowiki>
|-
| [[:List of causes of unexplained weight loss]] || <nowiki>==Causes of unexplained weight loss==</nowiki><br /><nowiki>====Malignant causes of unexplained weight loss====</nowiki>
|-
| [[:Nuclear fusion]] || <nowiki>==Requirements==</nowiki><br /><nowiki>====Gravitational confinement====</nowiki>
|-
| [[:O'Hare International Airport]] || <nowiki>==Airlines and destinations==</nowiki><br /><nowiki>====Cargo carriers====</nowiki>
|-
| [[:Olympiacos CFP]] || <nowiki>==Anthem==</nowiki><br /><nowiki>====In Greek====</nowiki>
|-
| [[:Perton]] || <nowiki>== History ==</nowiki><br /><nowiki>====Old Perton====</nowiki>
|-
| [[:Perton]] || <nowiki>==Countryside and Wildlife==</nowiki><br /><nowiki>====Wildlife====</nowiki>
|-
| [[:Red River Formation]] || <nowiki>==Lithology==</nowiki><br /><nowiki>====Subdivisions====</nowiki>
|-
| [[:Requirements analysis]] || <nowiki>=== Contract-style requirement lists ===</nowiki><br /><nowiki>=====Strengths=====</nowiki>
|-
| [[:RuneSoft]] || <nowiki>== Published titles ==</nowiki><br /><nowiki>==== Released ====</nowiki>
|-
| [[:Solidarity Youth Movement, Kerala]] || <nowiki>==Leadership==</nowiki><br /><nowiki>=====Presidents=====</nowiki>
|-
| [[:Stony Mountain Formation]] || <nowiki>==Lithology==</nowiki><br /><nowiki>====Subdivisions====</nowiki>
|-
| [[:Tamarind]] || <nowiki>==Description==</nowiki><br /><nowiki>====Alternative names====</nowiki>
|-
| [[:Telangana]] || <nowiki>==Separate Telangana state movement==</nowiki><br /><nowiki>=====1969 Movement =====</nowiki>
|-
| [[:Watrous Formation]] || <nowiki>==Lithology==</nowiki><br /><nowiki>====Subdivisions====</nowiki>
|-
| [[:Winter storms of 2009–2010]] || <nowiki>===December 30, 2009– January 7 ===</nowiki><br /><nowiki>=====The estimated European death tolls=====</nowiki>
|-
| [[:Winter storms of 2009–2010]] || <nowiki>===January 8th–9th===</nowiki><br /><nowiki>=====The UK's road salt and grit shortage crisis.=====</nowiki>
|-
| [[:World Supermodels Pageant]] || <nowiki>==Past Winners==</nowiki><br /><nowiki>====Reference====</nowiki>
|}
=== HTML table element (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Aphanizomenon flos-aquae (dietary supplement)]] || <nowiki>[[Image:Afatop_orig.jpg |thumb |alt=''Aphanizomenon flos-aquae'' |<div align="center"><table><tr><td </nowiki>
|-
| [[:Bangkok Glass F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Hydroxyquinone]] || <nowiki><table border=0 cellborder=0> </nowiki>
|-
| [[:Liga Deportiva Universitaria de Quito]] || <nowiki><table style="float: right; margin-left: 1em; margin-bottom: 0.5em; width: 180px; </nowiki>
|-
| [[:List of people from Lahore]] || <nowiki><table><tr><td valign=top> </nowiki>
|-
| [[:Marquess Cheng of Zhao]] || <nowiki><table border=1 width=250 cellpadding=2 cellspacing=0 align=right> </nowiki>
|-
| [[:Marquess Wu of Wei]] || <nowiki><table border=1 width=250 cellpadding=2 cellspacing=0 align=right> </nowiki>
|-
| [[:Muangthong United F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Norman Seeff]] || <nowiki><tr> </nowiki>
|-
| [[:Osotspa Saraburi F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Pattaya United F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Quadray coordinates]] || <nowiki><table><tr><td> </nowiki>
|-
| [[:Royal Thai Army F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Samut Songkhram F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:Sisaket F.C. season 2010]] || <nowiki><table style="float: center; width: 200px; border: 0px"> </nowiki>
|-
| [[:The Sporting News Manager of the Year Award]] || <nowiki><TABLE border="3" cellspacing="3" cellpadding="3"> </nowiki>
|-
| [[:The Sporting News Player of the Year Award]] || <nowiki><TABLE border="3" cellspacing="3" cellpadding="3"> </nowiki>
|-
| [[:Thingoe Rural District]] || <nowiki><TABLE> </nowiki>
|-
| [[:Tim Tebow]] || <nowiki><table border="0" cellpadding="3" cellspacing="0" id="Table3"> </nowiki>
|-
| [[:Toledo, Ohio]] || <nowiki><table border="0" width="100%" cellpadding="10"> </nowiki>
|-
| [[:University of Delhi]] || <nowiki><table style="width: 100%"> </nowiki>
|-
| [[:University of Illinois at Urbana–Champaign]] || <nowiki><td> </nowiki>
|-
| [[:Venus Williams career statistics]] || <nowiki><tr> </nowiki>
|-
| [[:Vienna]] || <nowiki><table><td><ol> </nowiki>
|-
| [[:Xavier Restituyo]] || <nowiki><tr><th> Quad </th><th> Total </th><th> Constellations </td></tr> </nowiki>
|}
=== HTML text style element <nowiki><small></nowiki> in ref, sub or sup ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Abortion in Albania]] || <nowiki>në Kuvendin Popullor të Shqipërisë.</small></ref> Abortion can be </nowiki>
|-
| [[:Cagayan de Oro City]] || <nowiki><sup><small>(Highly-urbanized City)</small></sup> | subdivision_type4 </nowiki>
|-
| [[:Circumcision]] || <nowiki>Encyclopedia, Sixth Edition, 2001-05.</small></ref>According to the </nowiki>
|-
| [[:Daphnandra apatela]] || <nowiki>2008, ISBN 9780958943673 <small>page 84</small></ref> The species name </nowiki>
|-
| [[:Dobrinja mortar attack]] || <nowiki>to end the slaughter in Bosnia.")</small></ref> Approximately 200 </nowiki>
|-
| [[:Dysoxylum mollissimum subsp. molle]] || <nowiki>ISBN 9780958943673 <small>page 220</small></ref>=== Leaves ===Leaflets </nowiki>
|-
| [[:Fils de France]] || <nowiki>p.277, ISBN-<small>13: 9781596910577.</small></ref>Between the death, </nowiki>
|-
| [[:Fort Bliss]] || <nowiki>Embassy in Mexico City.<sup><small>p406</small></sup></ref>In late 1953 </nowiki>
|-
| [[:Gang★]] || <nowiki>Name = Gang<sup><small>★</small></sup>| Artist </nowiki>
|-
| [[:Globalization]] || <nowiki>to.ca/research/iprp/c3n/CI/DMorris.htm]</small></ref><ref>[http://convention.allacademic.com/asa2003/view_paper_info.html?pub_id=179&part_id1=13161]Podobnik </nowiki>
|-
| [[:Great Plains]] || <nowiki>1,300,000 km<sup><small>2</small></sup>. Current thinking </nowiki>
|-
| [[:HEY!]] || <nowiki> = "[[Gang★|Gang<sup><small>★</small></sup>]]"<br />(2001)}}"'''HEY!'''" </nowiki>
|-
| [[:Kern River Preserve]] || <nowiki>213, 334.—S.C.B., 1893, I:1, p. 4.)</small></ref>The river flows </nowiki>
|-
| [[:Kerry Katona]] || <nowiki>15 October 2006)</small></ref> {{cquote|... I put </nowiki>
|-
| [[:Lee Seung Gi]] || <nowiki><small>Newsen.com, November 17, 2007.</small></ref> in the [[M.net KM </nowiki>
|-
| [[:Libyan Arab Airlines Flight 114]] || <nowiki>graphics|CG]]</small></sup> |Date = February </nowiki>
|-
| [[:Marcheline Bertrand]] || <nowiki>January 28, 2007</ref><sup><small>,</small></sup><ref>People magazine </nowiki>
|-
| [[:Mary Lou Retton]] || <nowiki>/Athletes/R/Retton-Mary-Lou.aspx<small></small></ref>In 1997, Retton </nowiki>
|-
| [[:Mercury (planet)]] || <nowiki>(1,370 W·m<sup><small>−2</small></sup>).<ref>{{cite book </nowiki>
|-
| [[:Muammar al-Gaddafi]] || <nowiki>al-Gaddafi'''<sup><small>[[#Name|1]]</small></sup> ({{lang-ar|معمر </nowiki>
|-
| [[:Roger Federer]] || <nowiki>Roger Federer as the best he has seen."</small></ref><ref>{{cite news </nowiki>
|-
| [[:Rosuvastatin]] || <nowiki>date reflects the last revision date.</small></ref>==Notes=={{reflist}}== </nowiki>
|-
| [[:Switzerland]] || <nowiki>Federal Chancellor [[Corina Casanova]])</small></ref>]]The [[Federal </nowiki>
|-
| [[:Thomas Carlyle]] || <nowiki>Galloway]], [[Scotland]]<sup><small>1</small></sup>| deathdate = {{death </nowiki>
|-
| [[:TI-92 series]] || <nowiki>.jpg|thumb|300px|''Voyage<sup><small>TM</small></sup> 200'']]'''Voyage </nowiki>
|}
=== Link equal to linktext (AWB, AutoEd, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010–11 Primera División de México season]] || <nowiki>[[Javier Hernandez|Javier Hernandez]] </nowiki>
|-
| [[:Arnab Basu]] || <nowiki>[[Visvesvaraya Technological University|Visvesvaraya Technological University]] </nowiki>
|-
| [[:Ayalew Birru]] || <nowiki>[[Begemder|Begemder]] </nowiki>
|-
| [[:Charlie Albright]] || <nowiki>[[Harvard University|Harvard University]] </nowiki>
|-
| [[:Countersoft]] || <nowiki>[[issue tracking system|issue tracking system]] </nowiki>
|-
| [[:County Championsship Midtjylland Tabletennis 2006]] || <nowiki>[[long|long]] </nowiki>
|-
| [[:EA Sports MMA]] || <nowiki>[[Vladimir Matyushenko|Vladimir Matyushenko]] </nowiki>
|-
| [[:Elections in Delhi]] || <nowiki>[[Delhi|Delhi]] </nowiki>
|-
| [[:Endsongs]] || <nowiki>[[The Strangest Things|The Strangest Things]] </nowiki>
|-
| [[:Golwg360]] || <nowiki>[[Welsh language|Welsh language]] </nowiki>
|-
| [[:Javelin (Music Duo)]] || <nowiki>[[Thrill Jockey|Thrill Jockey]] </nowiki>
|-
| [[:Juvenilia Press]] || <nowiki>[[Romanticism|Romanticism]] </nowiki>
|-
| [[:List of countries and territories by land and maritime borders]] || <nowiki>[[France|France]] </nowiki>
|-
| [[:List of gallantry award winners from the Nair community]] || <nowiki>[[Krishnan Narayan Nair|Krishnan Narayan Nair]] </nowiki>
|-
| [[:List of localities in Tasmania]] || <nowiki>[[West Tamar Council|West Tamar Council]] </nowiki>
|-
| [[:List of Sega Saturn games]] || <nowiki>[[Hop Step Idol |Hop Step Idol ]] </nowiki>
|-
| [[:Melbourne Heart season 2010–11]] || <nowiki>[[Newcastle Jets|Newcastle Jets]] </nowiki>
|-
| [[:Modestas mankus]] || <nowiki>[[Cardiff city|Cardiff city]] </nowiki>
|-
| [[:Norman Seeff]] || <nowiki>[[One of These Nights|One of These Nights]] </nowiki>
|-
| [[:Scarampi]] || <nowiki>[[Bishop of Belluno-Feltre|Bishop of Belluno-Feltre]] </nowiki>
|-
| [[:Special K Software]] || <nowiki>[[1992|1992]] </nowiki>
|-
| [[:Stygian Iron]] || <nowiki>[[River Styx|River Styx]] </nowiki>
|-
| [[:Surprise Hotel]] || <nowiki>[[CD|CD]] </nowiki>
|-
| [[:The Real Global Warming Disaster]] || <nowiki>[[carbon dioxide|carbon dioxide]] </nowiki>
|-
| [[:United Nations Security Council Resolution 550]] || <nowiki>[[Secretary-General|Secretary-General]] </nowiki>
|}
=== Reference list missing (partial AWB) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Barsanti-Matteucci Engine]] ||
|-
| [[:BB Owen]] ||
|-
| [[:Blackthorn (comics)]] ||
|-
| [[:CFRC- Campaign for Free Range Chicken]] ||
|-
| [[:Desegregated public schools in New Orleans]] ||
|-
| [[:EwingSIR]] ||
|-
| [[:George Kovács]] ||
|-
| [[:Gnomz]] ||
|-
| [[:Henry Rogerson]] ||
|-
| [[:HP Slate]] ||
|-
| [[:Jonathan Johansson (musician)]] ||
|-
| [[:Lauri Kytömaa]] ||
|-
| [[:Lowell NorEaster]] ||
|-
| [[:Marjorie's Quest]] ||
|-
| [[:Medical Arts Building (Atlanta, Georgia)]] ||
|-
| [[:Mlačiste]] ||
|-
| [[:Olivarez College]] ||
|-
| [[:Prof. Muhammad Waqas Khan]] ||
|-
| [[:Segugio Maremmano]] ||
|-
| [[:The Good Guy (film)]] ||
|-
| [[:Tiger in Chinese culture]] ||
|-
| [[:Titan Terrier]] ||
|-
| [[:To New Beginnings!]] ||
|-
| [[:Will Gompertz]] ||
|-
| [[:Yves tomic]] ||
|}
== Lowest Priority ==
=== HTML text style element <nowiki><font></nowiki> ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alex Roberts]] || <nowiki>! colspan=2 style="background:#A9A9A9" | <font color="white">MMA record</font>… </nowiki>
|-
| [[:Alvarezsaur]] || <nowiki> |label3= <font color="white">unnamed</font>… </nowiki>
|-
| [[:Bangkok Glass F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Basarrate Station]] || <nowiki>|zone=<font color="#FFB90F">Zone A</font>… </nowiki>
|-
| [[:Chet Upham]] || <nowiki>[[Image:Former Baker Hotel in Mineral Wells, TX Picture 2224.jpg|right|thumb|200px|<font… </nowiki>
|-
| [[:Claude Hall]] || <nowiki>| caption =<font size=2>Historian Claude H. Hall (1988)</font size=2… </nowiki>
|-
| [[:Etxebarri Station (Metro Bilbao)]] || <nowiki>|zone=<font color="#228B22">Zone B.0</font>… </nowiki>
|-
| [[:Liga Deportiva Universitaria de Quito]] || <nowiki>{{Image label|x=0.21|y=0.06|scale=610|text=<font size=2 color="gold">[[José Francisco… </nowiki>
|-
| [[:List of homing endonuclease cutting sites]] || <nowiki>* '''SF''': [[Structural family]]: any of the four established families for this… </nowiki>
|-
| [[:Muangthong United F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Osotspa Saraburi F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Pattaya United F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Royal Thai Army F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Samut Songkhram F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Semiotic elements and classes of signs (Peirce)]] || <nowiki>''Determination.'' A sign depends on its object in such a way as to represent its… </nowiki>
|-
| [[:Sisaket F.C. season 2010]] || <nowiki>{{Image label|x=0.26|y=0.09|scale=350|text=<font size=1 color="Black"></font>}}… </nowiki>
|-
| [[:Table of United States Metropolitan Statistical Areas and Their Names]] || <nowiki>[[Image:Core Based Statistical Areas.png|thumb|The 366 [[Metropolitan Statistical… </nowiki>
|-
| [[:The Gambia]] || <nowiki>|HDI_category = <font color="red">low</font>… </nowiki>
|-
| [[:Trinidad and Tobago]] || <nowiki>|HDI_category = <font color="#009900">high</font>… </nowiki>
|-
| [[:Tukey's test of additivity]] || <nowiki>where <font style="text-decoration: overline;">''Y''</font><sub>''i''•</sub> is… </nowiki>
|-
| [[:United States presidential election, 1848]] || <nowiki>| map_caption = Presidential election results map. <font color="#698DC5">'''Blue'''</font>… </nowiki>
|-
| [[:Variations of red]] || <nowiki> title= <font color="white">Pigment Red</font>… </nowiki>
|-
| [[:Vertebrate]] || <nowiki> |label3=<font color="white">unnamed</font>… </nowiki>
|-
| [[:Wichita Falls, Texas]] || <nowiki>[[Image:The Falls of the Wichita River, Wichita Falls, TX Picture 2217.jpg|200px|right|thumb|<font… </nowiki>
|-
| [[:Zapata, Texas]] || <nowiki>|image_caption = <font size=2>[[U.S. Highway 83]] in Zapata just south… </nowiki>
|}
=== HTML text style element <nowiki><p></nowiki> ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Baul]] || <nowiki><P>… </nowiki>
|-
| [[:British Jumping Derby]] || <nowiki><p>The DFS British Jumping Derby is one of those events a bit like the… </nowiki>
|-
| [[:Emergency Economic Stabilization Act of 2008]] || <nowiki><blockquote><p>1) Its fairness. The plan is a subsidy to investors at taxpayers’… </nowiki>
|-
| [[:End Node Problem]] || <nowiki><P>… </nowiki>
|-
| [[:History of Kathmandu]] || <nowiki><blockquote><p>"The country is about 4000 li in circuit, and is situated among the… </nowiki>
|-
| [[:History of the Commissioner of Major League Baseball]] || <nowiki><p>"You can't do that!" barked a surprised Wilbert Robinson, manager of the Brooklyn… </nowiki>
|-
| [[:Homeopathy]] || <nowiki> |currentprop='''Organizations:''' [[Boiron]], [[Heel (corporation)|Heel]], [[Miralus… </nowiki>
|-
| [[:How to make it in america]] || <nowiki><p>… </nowiki>
|-
| [[:I Gotta Feeling]] || <nowiki><p>… </nowiki>
|-
| [[:Ilario Pantano]] || <nowiki><p>Sergeant M said he believed the men were probably insurgents, and they were not… </nowiki>
|-
| [[:Indus River]] || <nowiki><blockquote><p>"Temperatures are rising four times faster than elsewhere in China,… </nowiki>
|-
| [[:La familia, la propiedad privada y el amor]] || <nowiki>:resultabas ser tú.<p>… </nowiki>
|-
| [[:Le Chatelier's principle]] || <nowiki>:<p>''If a chemical system at equilibrium experiences a change in [[concentration]],… </nowiki>
|-
| [[:List of orders, decorations, and medals of the Russian Federation]] || <nowiki><p>'''Replaced by the Border Guard Service of the FSS (ФСБ) on 11 March 2003'''</p… </nowiki>
|-
| [[:Lopez Negrete Communications]] || <nowiki><p>Lopez Negrete Communications, Inc. is the second-largest … </nowiki>
|-
| [[:Mulbekh Monastery]] || <nowiki><blockquote><p>.Oh Lama ([[Tsongkapa]] [1378-1441 CE]), take notice of this! The… </nowiki>
|-
| [[:Pete's Basement]] || <nowiki><p>… </nowiki>
|-
| [[:Raymond v. Raymond]] || <nowiki>The album sampler contains 6 tracks from the forthcoming album:<p>… </nowiki>
|-
| [[:Royal Tunbridge Wells]] || <nowiki><p>"They have made the wells very commodious by the many good building all about… </nowiki>
|-
| [[:Solo (Iyaz song)]] || <nowiki><p>… </nowiki>
|-
| [[:Steve Buyer]] || <nowiki><p>[Y]ou could have smoked that lettuce and you would still end up with the same… </nowiki>
|-
| [[:Temple Grandin]] || <nowiki>{{quotation|<p>I think using animals for food is an ethical thing to do, but we've… </nowiki>
|-
| [[:Ulysses S. Grant presidential administration scandals]] || <nowiki>[[Image:directors upr.jpg|thumb|150px|right|Directors of the [[Union Pacific Railroad]]… </nowiki>
|-
| [[:Union Station (Phoenix, Arizona)]] || <nowiki><p>The main station building is 475 feet long and 74 feet wide. The adjoining Post… </nowiki>
|-
| [[:Who Dat?]] || <nowiki><p>… </nowiki>
|}
=== Break in list (AWB, AutoEd, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1996 TFL Statewide League Season]] || <nowiki>* [[File:BurnieDockersTFLDesig … | 7.9 (51) | 10.14 (74)<br /> </nowiki>
|-
| [[:Awaken (The Empire Shall Fall Album)]] || <nowiki>*Photographer - Emily Stamp<br /></nowiki>
|-
| [[:Caroline Tschintschek]] || <nowiki>*Nancy Watson (1989)<br /></nowiki>
|-
| [[:Chad Lee (politician)]] || <nowiki>*John Nichols, [http://host.ma … Times,'' January 31, 2010.<br></nowiki>
|-
| [[:Chang H. Ahn]] || <nowiki>* Columnist of Maeil Business Newspaper <br /></nowiki>
|-
| [[:Construction Time Again Tour]] || <nowiki>* [[Andrew Fletcher (musician)|Andrew Fletcher]] - keyboards <br></nowiki>
|-
| [[:Cricket gaming awards]] || <nowiki>*[http://www.cricketgaming.net … wards 2010 Announcement]<br /></nowiki>
|-
| [[:Decentralization policy in K-League]] || <nowiki>* [http://www.kleague.com/klea … The History of K-League]<BR/></nowiki>
|-
| [[:Halcombe]] || <nowiki>* [http://www.nzetc.org/tm/sch … rly Picture of Halcombe]<br /></nowiki>
|-
| [[:Kimimon]] || <nowiki>* '''Medicine''' – The pets … ase their health levels.<br /></nowiki>
|-
| [[:Manuel de Mier y Terán]] || <nowiki>* [[Battle of Tehuacán]]<br/></nowiki>
|-
| [[:Merryland international]] || <nowiki>*MERRYLAND INTERNATIONAL SCHOO … (OPENING SEPTEMBER 2010)<br /></nowiki>
|-
| [[:No. 96 Squadron RAF]] || <nowiki>*[[Image:RAF_roundel.svg|20px]] Royal Flying Corps</br></nowiki>
|-
| [[:Paratrooper Battalion 261 (Germany)]] || <nowiki>*[[Kunduz Province Campaign|Operation Oqab]]<br></nowiki>
|-
| [[:Rachel Coleman (Worst Cooks in America)]] || <nowiki>* [http://www.foodnetwork.com/ … Cooks in America website] <br></nowiki>
|-
| [[:Right Now 2009 UK Tour]] || <nowiki>* Royal Concert Hall Nottingha … thread.php?t=930202</ref><br/></nowiki>
|-
| [[:Segugio Dell'Appennino]] || <nowiki>* Triangular ears with a large … rs have a rounded point.<br /></nowiki>
|-
| [[:Segugio Maremmano]] || <nowiki>*[http://www.segugiomaremmano. … no breeder, with photos]<br /></nowiki>
|-
| [[:Some Great Reward Tour]] || <nowiki>* [[Andrew Fletcher (musician)|Andrew Fletcher]] - keyboards <br></nowiki>
|-
| [[:The Futuristic Sounds of Sun Ra]] || <nowiki>*Ricky Murray - Vocals on 'China Gate'<br /></nowiki>
|-
| [[:The Poldark Novels]] || <nowiki>* Graham mentions in his autob … ife, Jean, a Cornishwoman.<br></nowiki>
|-
| [[:Time]] || <nowiki>* [[chaotic inflation]], in wh … 1 |year=1986 |pages=81}}<br /></nowiki>
|-
| [[:Wednesbury Old Athletic F.C.]] || <nowiki>* {{flagicon|ENG}} [[George Ho … s/WednesburyOA.html</ref><br/></nowiki>
|-
| [[:Zatoichi The Fugitive]] || <nowiki>* Several Zatoichi films will … The Japan Society]</ref><br /></nowiki>
|-
| [[:Zazerkalie (theatre)]] || <nowiki>* " ''Through the Looking-Glass'' ".<br /></nowiki>
|}
=== Category before last headline (AWB, PY, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Aaron Cruden]] || <nowiki>[[Category:Hurricanes rugby union players]]</nowiki>
|-
| [[:Aeronor Flight 304]] || <nowiki>[[Category:Aviation accidents and incidents in Chile]]</nowiki>
|-
| [[:Banteer GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Boherbue GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Castlemagner GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Christopher Jefferies]] || <nowiki>[[Category:Proposed deletion-endorsed]]</nowiki>
|-
| [[:Don't Sweat It]] || <nowiki>[[Category:Home renovation television series]]</nowiki>
|-
| [[:Dromtarriffe GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:I. Stanford Jolley]] || <nowiki>[[Category:Deaths from emphysema]]</nowiki>
|-
| [[:Kilbrin GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Kiskeam GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Knocknagree GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Kuunkuiskaajat]] || <nowiki>[[Category:Finnish Eurovision Song Contest entrants]]</nowiki>
|-
| [[:Lara Bohinc]] || <nowiki>[[Category:Articles created via the Article Wizard]]</nowiki>
|-
| [[:Le Militant]] || <nowiki>[[Category:Newspapers published in Mauritius]]</nowiki>
|-
| [[:Leica Standard]] || <nowiki>[[Category:Rangefinder cameras]]</nowiki>
|-
| [[:Lismire GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Lyre GAA]] || <nowiki>[[Category:Gaelic football clubs in County Cork]]</nowiki>
|-
| [[:Maltese Player of the Year]] || <nowiki>[[Category:Football in Malta]]</nowiki>
|-
| [[:Nobody But a Fool (Would Love You)]] || <nowiki>[[Category:Songs written by Bill Anderson]]</nowiki>
|-
| [[:Order 66 podcast]] || <nowiki>[[Category:Audio podcasts]]</nowiki>
|-
| [[:Orgasm Inc.]] || <nowiki>[[Category:English-language films]]</nowiki>
|-
| [[:The Sterling Currency in the South Atlantic and the Antarctic]] || <nowiki>[[Category:numismatics]]</nowiki>
|-
| [[:Tyrone Ellis]] || <nowiki>[[Category:Southern Nazarene Crimson Storm men's basketball players]]</nowiki>
|-
| [[:ZPHS Dharmaram]] || <nowiki>[[Category:High schools in India]]</nowiki>
|}
=== DEFAULTSORT missing for titles with special letters (partial AWB, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Aïn El Hammam District]] ||
|-
| [[:Béni Douala District]] ||
|-
| [[:Béni Yenni District]] ||
|-
| [[:Björgvin Björgvinsson]] ||
|-
| [[:Błękitny Wieżowiec]] ||
|-
| [[:Héliopolis, Algeria]] ||
|-
| [[:Ibăneşti, Vaslui]] ||
|-
| [[:한국 영상 자료원]] ||
|-
| [[:한국영상 자료원]] ||
|-
| [[:한국영상자료원]] ||
|-
| [[:Maâtka District]] ||
|-
| [[:Näläntöjärvi]] ||
|-
| [[:Pääjärvi (Karstula)]] ||
|-
| [[:Pääjärvi (Lammi)]] ||
|-
| [[:Pälkänevesi]] ||
|-
| [[:Pöyrisjärvi]] ||
|-
| [[:Sälevä]] ||
|-
| [[:Särkijärvi]] ||
|-
| [[:Sêrkog]] ||
|-
| [[:Trần Phú]] ||
|-
| [[:Västgötska]] ||
|-
| [[:Ōzawanai Station]] ||
|-
| [[:Šmalčja vas]] ||
|-
| [[:Čadraže]] ||
|-
| [[:Čisti Breg]] ||
|}
=== Headline ALL CAPS ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:AIM-120 AMRAAM]] || <nowiki>====ACEVAL/AIMVAL====</nowiki>
|-
| [[:B-47 Stratojet]] || <nowiki>===RB-47E/RB-47H/ERB-47H/RB-47K===</nowiki>
|-
| [[:Delaware Lottery]] || <nowiki>==MULTI-WIN LOTTO==</nowiki>
|-
| [[:Dodge Ram]] || <nowiki>==2002–2008 (DR/DH/D1/DC/DM)==</nowiki>
|-
| [[:DWRR-FM]] || <nowiki>===DWWK/DWOK-FM (1973-1986)===</nowiki>
|-
| [[:Effects of the Turkey – Kurdistan Workers' Party conflict]] || <nowiki>===HEP/DEP/HADEP===</nowiki>
|-
| [[:ERDAS IMAGINE]] || <nowiki>===ERDAS IMAGINE===</nowiki>
|-
| [[:GM Family II engine]] || <nowiki>==D-TEC/E-TEC II==</nowiki>
|-
| [[:Hammond organ]] || <nowiki>====B-2 / C-2 / RT / RT-2 / E / C / D====</nowiki>
|-
| [[:HD DVD]] || <nowiki>===HD DVD-R / -RW / -RAM===</nowiki>
|-
| [[:Isolation (database systems)]] || <nowiki>===READ UNCOMMITTED===</nowiki>
|-
| [[:Kimi e...]] || <nowiki>=== CD2 - MAYU☆FUYU SELECTION ===</nowiki>
|-
| [[:KMC International Center]] || <nowiki>==FAIMER/IMED==</nowiki>
|-
| [[:Lexus LS]] || <nowiki>=== USF40 II / USF41 II (2009) ===</nowiki>
|-
| [[:List of fan fiction terms]] || <nowiki>===AU/AT/AR/AH===</nowiki>
|-
| [[:Millennium Foundation]] || <nowiki>==MASSIVEGOOD==</nowiki>
|-
| [[:NASCAR 99]] || <nowiki>==NASCAR 99 LEGACY==</nowiki>
|-
| [[:P-47 Thunderbolt]] || <nowiki>===P-47D / P-47G / XP-47K / XP-47L===</nowiki>
|-
| [[:PAL]] || <nowiki>==== PAL B/G/D/K/I ====</nowiki>
|-
| [[:Rajiv Gandhi Technical University]] || <nowiki>==BEC/GEC/UIT-RGPV==</nowiki>
|-
| [[:Ramesh Nadkarni]] || <nowiki>====RAGA – BAIRAGI BHAIRAV====</nowiki>
|-
| [[:Second Armistice at Compiègne]] || <nowiki>===ARTICLE XXIV.===</nowiki>
|-
| [[:Show Luo]] || <nowiki>====SHOW YOUR DANCE====</nowiki>
|-
| [[:Thurakapalem]] || <nowiki>== MAA UURU ANNA NAAKU GARVAM ==</nowiki>
|-
| [[:Windows Registry]] || <nowiki>==== HKEY_DYN_DATA ====</nowiki>
|}
=== Headline with HTML (AutoEd, PY) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Aquarium therapy]] || <nowiki><h2>references</h2><references/></nowiki>
|-
| [[:Ballard High School (Louisville, Kentucky)]] || <nowiki><h2><span class="editsection"></span> <span class="mw-headline"</nowiki>
|-
| [[:Bansal Institue of Science and Technology]] || <nowiki><h2>courses</h2>the institute runs several ug and</nowiki>
|-
| [[:Bansal Institute of Science and Technology]] || <nowiki><h2>courses</h2>the institute runs several ug and</nowiki>
|-
| [[:Demographics of the United States]] || <nowiki><h6> </nowiki>
|-
| [[:Information sensitivity]] || <nowiki><h4>n<br />o<br />n<br />-<br />c<br />l<br />a<br</nowiki>
|-
| [[:Lopez Negrete Communications]] || <nowiki><h2>overview </h2><p>since 1985, the agency’s vision</nowiki>
|-
| [[:Miguel Ángel Virasoro]] || <nowiki><h5>articles and reviews:</h5><ul><li>1952: my philosophy,</nowiki>
|-
| [[:Multiplicity-one theorem]] || <nowiki><h2>multiplicity-one theorem</h2> each irreducible</nowiki>
|-
| [[:National Bicycle League]] || <nowiki><h5> </nowiki>
|-
| [[:Platform for Agrobiodiversity Research]] || <nowiki><h2>history</h2>conservation, enhancement and use</nowiki>
|-
| [[:Steven G. Kellman]] || <nowiki><h3>background and education</h3>kellman was born</nowiki>
|-
| [[:Tubal reversal]] || <nowiki><h3>pregnancy rates by age</h3><p>as expected, younger</nowiki>
|-
| [[:United States Bicycle Motocross Association]] || <nowiki><h5> </nowiki>
|-
| [[:University of Delhi]] || <nowiki><h3>list of chancellors</h3> </nowiki>
|-
| [[:University of Florida: Forensic Science Distance Education Programs]] || <nowiki><h2>program overview</h2>the university of florida’s</nowiki>
|-
| [[:Wairarapa Line]] || <nowiki><h4>wellington section</h4>|-! distance from wellington!</nowiki>
|-
| [[:Whispurr]] || <nowiki><h2>functions</h2>it is possible to post videos on</nowiki>
|}
=== Headlines with bold (partial AWB, AutoEd, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:List of Egyptian hieroglyphs by common name: A-L]] || <nowiki>===First uniliteral (kh)--'''ḫ'''===</nowiki>
|-
| [[:List of Egyptian hieroglyphs by common name: A-L]] || <nowiki>===Second uniliteral (kh)--'''ẖ'''===</nowiki>
|-
| [[:List of Egyptian hieroglyphs by common name: A-L]] || <nowiki>===First uniliteral h--'''h'''===</nowiki>
|-
| [[:List of Egyptian hieroglyphs by common name: A-L]] || <nowiki>===Second uniliteral h--'''ḥ'''===</nowiki>
|-
| [[:List of Orthodox churches in Toronto]] || <nowiki>==Canonical Orthodox Churches{{#tag:ref|Members of the '''Canadian Conference of</nowiki>
|-
| [[:List of Orthodox churches in Toronto]] || <nowiki>==Non-Canonical Churches{{#tag:ref|Not members of the '''Canadian Conference of Orthodox</nowiki>
|}
=== HTML list elements ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Asian University of Bangladesh]] || <nowiki>|dean = <li>Md. Ashraf Hossain,The School of Business,<br /><li>Dr. S.M. Azharul </nowiki>
|-
| [[:Asymptotic theory (statistics)]] || <nowiki><ul> </nowiki>
|-
| [[:Bangsar]] || <nowiki>[[image:bangsarmap.png|300px|thumb|left|Neighbourhoods within Bangsar: <ol> </nowiki>
|-
| [[:Calian Technologies Ltd.]] || <nowiki><li>Content Management</li> </nowiki>
|-
| [[:Craps]] || <nowiki><li> play within one's means (i.e. within one's budget, a.k.a. bankroll) </nowiki>
|-
| [[:Erica Kane]] || <nowiki>| occupation = </small></li><li> Fusion Cosmetics Executive </small></li><li>Former </nowiki>
|-
| [[:Eye color]] || <nowiki><li>Light eyes</li> </nowiki>
|-
| [[:Internet car buying in the UK]] || <nowiki><LI>The car may be bought at an auction where private sellers cannot bid. </nowiki>
|-
| [[:Islamic ethics]] || <nowiki><li>Islam is the religion that heavily focuses on character building and doesn’t </nowiki>
|-
| [[:Israel Shipyards]] || <nowiki><li>[[Sa'ar 4-class missile boat]]</li> </nowiki>
|-
| [[:Jammer keyboard]] || <nowiki><ol><li>at least one [[isomorphic keyboard]], and </nowiki>
|-
| [[:Liquid crystal display]] || <nowiki><ol><li>[[polarizer|Polarizing filter]] film with a vertical axis to polarize light </nowiki>
|-
| [[:Lone Star College System]] || <nowiki>;[[Lone Star College–CyFair]] (uninc. Harris County) : Lone Star College–CyFair, </nowiki>
|-
| [[:Nokia N900]] || <nowiki><li>2GB as [[ext3]] mounted to [[Filesystem Hierarchy Standard|/home]]</li> </nowiki>
|-
| [[:Semiotic elements and classes of signs (Peirce)]] || <nowiki><OL> </nowiki>
|-
| [[:Shidler College of Business]] || <nowiki><ul> </nowiki>
|-
| [[:Skybuilt Power]] || <nowiki><li> the SkyStation, a complete power station that can be set up in rugged climates </nowiki>
|-
| [[:Solar electrician]] || <nowiki><ul> </nowiki>
|-
| [[:Tennessee Volunteers football]] || <nowiki><ol> </nowiki>
|-
| [[:Top Gear (2002 TV series)]] || <nowiki>[[Image:TopGearHosts.jpg|thumb|250px|<ol> </nowiki>
|-
| [[:Units of measurement]] || <nowiki><ol> </nowiki>
|-
| [[:University of North Carolina at Greensboro]] || <nowiki><ul><li>Accounting </nowiki>
|-
| [[:WCG (firm)]] || <nowiki><ul> </nowiki>
|-
| [[:Where or When]] || <nowiki>| Chart position = <li>#98 <small>([[Billboard Hot 100|U.S.]])</small></li> </nowiki>
|-
| [[:Windows Server 2008]] || <nowiki><ul> </nowiki>
|}
=== HTML text style element <nowiki><b></nowiki> (AWB, AutoEd, partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alliance for Democracy (UK)]] || <nowiki>|remarks = <b>Ideology:</b><br>[[English nationalism]],<br>[[Christian democracy]],<br>[[Anti-corruption]… </nowiki>
|-
| [[:Barshi]] || <nowiki><b>GIRISH AGENCIES.</br>… </nowiki>
|-
| [[:Blug]] || <nowiki><b><i>This information was recently discovered in a dig site around Bethsaida, Israel.… </nowiki>
|-
| [[:Cathay Pacific fleet]] || <nowiki>''Note 2: B-KPL carries the'' <b>one</b>world ''special livery''<br>… </nowiki>
|-
| [[:Durga]] || <nowiki>*<b>[http://www.netglimse.com/holidays/durga_puja/index.shtml DURGA PUJA at NetGlimse.com]</b… </nowiki>
|-
| [[:Eugene School District]] || <nowiki><b>Board Members:</b>… </nowiki>
|-
| [[:Fred Hartman Bridge]] || <nowiki>|material=<b>cables:</b> polymer-wrapped twisted steel wire bundles<br><b>pylons:</b>… </nowiki>
|-
| [[:Gurunathanmukadi]] || <nowiki><b>Road</b>… </nowiki>
|-
| [[:History of sound recording]] || <nowiki>In the 1920s, when the first [[talkies]] came out, especially ''The Jazz Singer'',… </nowiki>
|-
| [[:Jumbles Country Park]] || <nowiki>|official_name= <b>Jumbles Country Park</b>… </nowiki>
|-
| [[:Jumbles Reservoir]] || <nowiki>|official_name= <b>Jumbles Reservoir</b>… </nowiki>
|-
| [[:Lawrence Hunter]] || <nowiki>| prizes =<b>Engelmore Prize for Innovative Applications of Artificial… </nowiki>
|-
| [[:Maps & Atlases]] || <nowiki><b>BEGINNING</b><br>… </nowiki>
|-
| [[:Mircea Basarab]] || <nowiki><b>Mircea Basarab</b> is a [[fictional character]] in [[The Cassandra Palmer series]]… </nowiki>
|-
| [[:Moss Bank Park, Bolton]] || <nowiki>|official_name= <b>Moss Bank Park</b>… </nowiki>
|-
| [[:Pinellas County, Florida]] || <nowiki>* [http://visitstpeteclearwater.com <b>VisitStPete/Clearwater.com,</b>] the official… </nowiki>
|-
| [[:Preston University Pakistan]] || <nowiki><b> <u> Preston Management </b></u>… </nowiki>
|-
| [[:Providence and Worcester Railroad]] || <nowiki><tr><td colspan=4 align=center><b>… </nowiki>
|-
| [[:Queen's Park, Bolton]] || <nowiki>|official_name= <b>Queen's Park</b>… </nowiki>
|-
| [[:Semaphore (programming)]] || <nowiki>Counting semaphores are accessed using operations similar to the following [[Pascal… </nowiki>
|-
| [[:Slowness (seismology)]] || <nowiki><b> Γ= ΣsiΔxi </b> … </nowiki>
|-
| [[:The Cassandra Palmer series]] || <nowiki><b>The Cassandra Palmer series</b> is a set of [[fantasy novels]] written by [[Karen… </nowiki>
|-
| [[:Trainz]] || <nowiki>Cite Sm|q="DRIVER"=<b>Operations 'sessions'</b>, defined in SURVEYOR, which define… </nowiki>
|-
| [[:Victoria Park, Swinton]] || <nowiki>|official_name= <b>Victoria Park</b>… </nowiki>
|-
| [[:Whispurr]] || <nowiki><b>Whispurr </b>is a free social networking and micro-blogging website which allows… </nowiki>
|}
=== HTML text style element <nowiki><i></nowiki> (AWB, AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alliance for Democracy (UK)]] || <nowiki>|motto = <i>Working together for the people the politicians forgot</i>… </nowiki>
|-
| [[:Border Collie]] || <nowiki> | isbn = 354063293X }}</ref> (1861? - 1945) of [[Christchurch]], [[New Zealand]],… </nowiki>
|-
| [[:Cogito ergo sum]] || <nowiki><blockquote><i>… </nowiki>
|-
| [[:Cowryz magazine]] || <nowiki>{{dated prod|concern = non-notable magazine lacking Ghit and GNEWS. [[User:Ttonyb1|<span… </nowiki>
|-
| [[:Culture of the United States]] || <nowiki>In sharp contrast to most other [[developed nations]], [[Gun law in the United States|firearms… </nowiki>
|-
| [[:Danny Andrew]] || <nowiki>| dateofbirth = <i>unknown</i>… </nowiki>
|-
| [[:Dion Lewis]] || <nowiki>Following the conclusion of the regular season, Lewis was named the National Freshman… </nowiki>
|-
| [[:Dreamer (band)]] || <nowiki><i>Possible participants as described by DREAM Event Producer Keiichi Sasahara at… </nowiki>
|-
| [[:Extrasolar planet]] || <nowiki>When a planet is found by the radial-velocity method, its orbital inclination <i>i</i>… </nowiki>
|-
| [[:Friedrich von Hayek]] || <nowiki>Hayek's words and actions concerning Chile under the Pinochet regime have drawn criticism… </nowiki>
|-
| [[:Frogger]] || <nowiki>/2009/2009_11_04_FroggerReturns_New_Screens.pdf |title=Konami reveals new screenshots… </nowiki>
|-
| [[:Glycolic acid]] || <nowiki>Due to its excellent capability to penetrate [[skin]], glycolic acid finds applications… </nowiki>
|-
| [[:Howard Zinn]] || <nowiki>On a post-doctoral research mission nine years after those bombing missions, Zinn… </nowiki>
|-
| [[:Labrador Retriever]] || <nowiki>In his book <i>Excursions In and About Newfoundland During the Years 1839 and 1840</i>,… </nowiki>
|-
| [[:List of Dead Like Me characters]] || <nowiki>'''Angus Cook''' ([[John Kapelos]]). Angus Cook appeared in a couple of episodes… </nowiki>
|-
| [[:List of The New School people]] || <nowiki>* [[Jack Kerouac]], <i>On the Road</i> <ref>http://famouspoetsandpoems.com/poets/jack_kerouac/biography</ref… </nowiki>
|-
| [[:Prosper Australia]] || <nowiki>The '''Land Values Research Group''' ('''LVRG'''), which was founded in 1943 as a… </nowiki>
|-
| [[:Russell T Davies]] || <nowiki>Davies and [[Gareth Roberts (writer)|Gareth Roberts]] have co-written another ''Doctor… </nowiki>
|-
| [[:Socialism]] || <nowiki><blockquote>It is not the consciousness of [people] that determines their existence,… </nowiki>
|-
| [[:Soularflair]] || <nowiki>While the first 2 albums were non-exclusively distributed by <i>Blue Pie</i><ref>http://www.bluepierecords.com/artist-roster.php?alphabet=S-Z&page=3#browse</ref>,… </nowiki>
|-
| [[:Telithromycin]] || <nowiki>Most common side-effects are gastrointestinal, including diarrhea, nausea, abdominal… </nowiki>
|-
| [[:Tom Alter]] || <nowiki>In 1996 he appeared in the [[Assamese language|Assamese-language]] film ''[[Adajya]]'',… </nowiki>
|-
| [[:United States gubernatorial elections, 2009]] || <nowiki>The CNMI election was held on Saturday, November 7, 2009.<ref name=mvarietyOct13>… </nowiki>
|-
| [[:Voodoo (Alexz Johnson album)]] || <nowiki>All songs are written by [[Alexz Johnson]] and Brendan Johnson, and produced by Brendan… </nowiki>
|-
| [[:Wizard of Oz experiment]] || <nowiki><blockquote><i>… </nowiki>
|}
=== HTML text style element <nowiki><small></nowiki> double ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Alan Sugar]] || <nowiki>2007}}{{Infobox Person|name = <small><small>[[The Right Honourable]]</small></small><br/>Th </nowiki>
|-
| [[:Bosnia and Herzegovina]] || <nowiki>=Bosna i Hercegovina <small><small>([[bosnian language|<font </nowiki>
|-
| [[:Brand New Eyes]] || <nowiki>[[#Release history|release history]])</small></small>| Recorded </nowiki>
|-
| [[:Deus Ex]] || <nowiki><small>([[PlayStation 2|PS2]])</small> </small> <br />[[Steam </nowiki>
|-
| [[:Eckerd Open]] || <nowiki>Federal Open <small>(1977–85)</small></small><br />Eckerd Open </nowiki>
|-
| [[:French people]] || <nowiki>people - mosaic.PNG|350px]]<small><small> 1<sup>st</sup> row: </nowiki>
|-
| [[:Gianfranco Fini]] || <nowiki>Officeholder| honorific-prefix = <small><small>[[Italian honorifics|Onorevole]]</small></small </nowiki>
|-
| [[:Gujarati people]] || <nowiki> = |caption = <small><small> 1<sup>st</sup> row: </nowiki>
|-
| [[:Hazel McCallion]] || <nowiki>name = Hazel McCallion<br><small><small><small>[[Member of </nowiki>
|-
| [[:Ho Chi Minh City]] || <nowiki>Y|other_name = <small><small>Formerly Saigon (<small><small>Vietnamese </nowiki>
|-
| [[:Jean-Daniel Lafond]] || <nowiki>Dr. Jean-Daniel Lafond<br><small><small>[[Order of Canada|CC]] </nowiki>
|-
| [[:Jorge Lorenzo]] || <nowiki>Prix career statistics==<small><small><ref name="MotoGP.com </nowiki>
|-
| [[:List of largest mosques]] || <nowiki>1}}<small><small>Masjid al-Haram, </nowiki>
|-
| [[:Lynden, Washington]] || <nowiki> = Lynden, Washington<br><small><small>[[Nooksack language|Nooksack]]:</small </nowiki>
|-
| [[:Maria Orsola Bussone]] || <nowiki>Person| name = <small><small>[[Servant of God]]</small></small><br> </nowiki>
|-
| [[:Nicole Walker]] || <nowiki>with EJ; deceased November 24, 2008)</small> </small> | grandparents </nowiki>
|-
| [[:Pogo (comics)]] || <nowiki><small>yassuh yassuh <small>yassuh...</small></small> ''[tosses baby </nowiki>
|-
| [[:Port-au-Prince]] || <nowiki> = (Vil Pòtoprens <small><small>in [[Haitian Creole </nowiki>
|-
| [[:Punjabi people]] || <nowiki>of Punjabis]]:'''<br> <small><small>1<sup>st</sup> row: </nowiki>
|-
| [[:Richard Bingham, 7th Earl of Lucan]] || <nowiki>{{Infobox Person|name = <small><small>[[The Right Honourable]]</small></small><br>Th </nowiki>
|-
| [[:Seoul Subway Line 1]] || <nowiki>1호선<br>首都圈 電鐵 1號線<br><small><small>''Sudogwon Jihacheol </nowiki>
|-
| [[:Sikh]] || <nowiki>= 2008-04-04}}</ref><center><small><small>Other significant </nowiki>
|-
| [[:The Circus Starring Britney Spears]] || <nowiki><small>(Canada)</small></small><ref name=jordin>{{cite </nowiki>
|-
| [[:They Liked You Better When You Were Dead]] || <nowiki>[[#Release history|release history]])</small></small>| Recorded </nowiki>
|-
| [[:Turkish people]] || <nowiki>|caption = <small><small> 1<sup>st</sup> row: </nowiki>
|}
=== Image description ends with break (AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Ballonet]] || <nowiki>[[File:Ballonet-Anlage des Parseval-Luftschiffes LA2-Blitz-0246 blank.png|thumb|right|Ballonet system in a semi-rigid [[Parseval airships|Parseval airship]]:<br /> J air pump,<br /> KK flap-valves in the air lines,<br /> LL air inlets into the ballonets,<br /> M maneuvering vent,<br /> U overpressure valve in gas cell,<br /> VV overpressure valves in ballonets.<br />]] </nowiki>
|-
| [[:Chicago Midway International Airport]] || <nowiki>[[File:Chicago-Midway1A.JPG|thumb|right|Destinations served from Chicago-Midway<br>]] </nowiki>
|-
| [[:Cian Healy]] || <nowiki>[[File:cianhealy.jpg|106px|<br/>|{{deletable image-caption|1=Wednesday, 1 July 2009}}]] </nowiki>
|-
| [[:Crèvecœur-le-Grand]] || <nowiki>[[File:<br />|270px]] </nowiki>
|-
| [[:Dommartin-sous-Amance]] || <nowiki>[[File:<br>|270px]] </nowiki>
|-
| [[:Estonian Academy of Sciences]] || <nowiki>[[File:Kohtu 6, Tallinn.IMGP6035.JPG|thumb|250px|[[Ungern-Sternberg]] palace on [[Toompea]], nowadays the main building of Estonian Academy of Sciences (Kohtu Street 6, built 1865–1868, architect [[Martin Gropius]])<br>]] </nowiki>
|-
| [[:Jamie Heaslip]] || <nowiki>[[File:Heaslip2.jpg|200px|<br/>]] </nowiki>
|-
| [[:Japanese general election, 2009]] || <nowiki>[[File:45th House of Representatives of Japan Seat Composition.png|thumb|Seating after the election.<br />{{colorbox|#FF8080}} [[Democratic Party of Japan|Democratic Party]] (308)<br />{{colorbox|#00FFFF}} [[Liberal Democratic Party (Japan)|Liberal Democratic Party]] (119)<br />{{colorbox|#FFFF00}} [[New Komeito Party|Komeito Party]] (21)<br />{{colorbox|#000000}} [[Japanese Communist Party|Communist Party]] (9)<br />{{colorbox|#FFB950}} [[Social Democratic Party (Japan)|Social Democratic Party]] (7)<br />{{colorbox|#FF004C}} [[Your Party]] (5)<br />{{colorbox|#3CE100}} [[People's New Party]] (3)<br />{{colorbox|#D278FF}} [[Independent (politician)|Independents / Others]] (8)<br />]] </nowiki>
|-
| [[:John J. Pershing]] || <nowiki>[[File:PershingRibbons.jpg|thumb|right|325px|General Pershing's ribbons as they would appear today<br/>]] </nowiki>
|-
| [[:Kingdom Hearts coded]] || <nowiki>[[File:CodedChar.png|thumb|left|Artwork of the cast of Kingdom Hearts coded. (From left to Right)<br/>(Bottom Row) Donald Duck, King Mickey, Jiminy Cricket, Goofy<br/>(Middle Row) Kairi, Sora and Riku<br/>(Top Row) Jiminy's Journal (taking form of a Cloaked Figure)<br/>]] </nowiki>
|-
| [[:List of countries by GDP (PPP) per capita]] || <nowiki>[[File:Average GDP PPP per capita.svg|thumb|right|350px|World map showing countries above and below the world average GDP (PPP) per capita. Source: CIA World Factbook.<br><span style="color:#138ae1">██</span> above world average<br><span style="color:#ff8204">██</span> below world average<br>]] </nowiki>
|-
| [[:Northrop A-17]] || <nowiki>[[File:A-17A 36-0207 USAFM.jpg|thumb|right|300px|A-17A '''36-0207'''<br />]] </nowiki>
|-
| [[:Reilly, Oise]] || <nowiki>[[File:<br />|270px]] </nowiki>
|-
| [[:Trie-Château]] || <nowiki>[[File:<br />|270px]] </nowiki>
|-
| [[:University of Otago Clocktower complex]] || <nowiki>[[File:University of Otago Clocktower complex map.svg|thumb|250px|right|Map of the Clocktower complex<br/>1. Registry/Clocktower building<br/>2. Geology Block<br/>3. Professorial Houses (2)<br/>4. Staff Club<br/>5. Marama Hall<br/>6. School of Mines / Archway building<br/>7. Allen Hall Theatre<br/>8. Home Science<br/>9. St David Street footbridge<br/>10. Union Street bridge<br/>]] </nowiki>
|}
=== Image description with full <nowiki><small></nowiki>. ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1915 in poetry]] || <nowiki>[[File:T S Eliot Simon Fieldhouse.jpg|thumb|150px|right|<small>Drawing by [[Simon Fieldhouse]]</small>]] </nowiki>
|-
| [[:Adam's Bridge]] || <nowiki>[[File:The Monkeys and Bears Build a Bridge to Lanka.jpg|left|thumb|<small>A 19th century painting depicting a scene from [[Ramayana]], wherein Monkeys and Bears are shown building a bridge to [[Lanka]]</small>]] </nowiki>
|-
| [[:Architecture of metropolitan Detroit]] || <nowiki>[[File:Guardianinterior.jpg|thumb|200px|right|<small/>The [[Guardian Building]], a [[National Historic Landmark]] by [[Wirt Rowland]].</small>]] </nowiki>
|-
| [[:Charles Lindbergh]] || <nowiki>[[File:WE cover.jpg|thumb|left|125px|<small>First Edition cover</small>]] </nowiki>
|-
| [[:Christian Church]] || <nowiki>[[File:Nasrani Evolution.jpg|thumb|right || <small>Relationship of the Nasrani ([[Saint Thomas Christian tradition|Saint Thomas Christian]]) groups </small>]] </nowiki>
|-
| [[:East Germany]] || <nowiki>[[File:DDR economy-en.svg|thumb|275px|right|<small>'''The East German economy.'''</small>]] </nowiki>
|-
| [[:Flag of Scotland]] || <nowiki>[[File:Scottish Government logo.png|thumb|right|<small>[[Scottish Government]] logo</small>]] </nowiki>
|-
| [[:Florence Baptistery]] || <nowiki>[[File:South Doors Florence Baptistry schema.jpg|thumb|left|<small>'''Scenes on the south doors''' (Andrea Pisano)''' 1.''' The angel announces to Zachariah. '''2.''' Zachariah is struck mute '''3.''' Visitation '''4.''' Birth of the Baptist.''' 5.''' Zachariah writes the boy's name. '''6.''' St John as boy in the desert. '''7.''' He preaches to the Pharisees. '''8.''' He announces Christ. '''9.''' Baptism of his disciples. '''10.''' Baptism of Jesus. '''11.''' St John reprimands Herod Antipas. '''12.''' Incarceration of St. John. '''13.''' The disciples visit St. John. '''14.''' The disciples visit Jesus. '''15.''' Dance of Salome. '''16.''' Decapitation of St. John. '''17.''' Presentation of St John's head to Herod Antipas. '''18.''' Salome takes the head to Herodias '''19.''' Transport of the body of St. John. '''20.''' Burial. '''A.''' Hope '''B.''' Faith '''C.''' Charity '''D.''' Humility '''E.''' Fortitude '''F.''' Temperance '''G.''' Justice '''H.''' Prudence </small>]] </nowiki>
|-
| [[:Free will]] || <nowiki>[[File:FreeWillTaxonomy2.svg|right|thumb|250px|<small>A simplified [[taxonomy]] of the most important philosophical positions regarding free will.</small>]] </nowiki>
|-
| [[:Gloria Estefan]] || <nowiki>[[File:GloriaEstefan.jpg|right|210px|thumb|<small>Gloria Estefan performs for the crew and their families during a special event to celebrate the United Through Reading program aboard the [[Nimitz class aircraft carrier]] [[USS Theodore Roosevelt (CVN-71)]], 14 September 2006</small>]] </nowiki>
|-
| [[:Indigenous Amerindian genetics]] || <nowiki>[[File:ADN animation.gif|thumb|right|110px| <small>DNA [[double helix]]</small>]] </nowiki>
|-
| [[:Marg (magazine)]] || <nowiki>[[File:Army and Navy Building.JPG|left|thumb|140px|<small>The historic Army & Navy Building in [[Kala Ghoda]], [[Mumbai]], with Marg Publications on the third floor.</small>]] </nowiki>
|-
| [[:National University of San Marcos]] || <nowiki>[[File:Sanmarcos05.jpg|thumb|250px|<small>Oil regarding the founding of the University of Lima (later named San Marcos), officially the first university Peru and America, And his manager Fray Tomas de San Martin.</small>]] </nowiki>
|-
| [[:Oliver P. Smith]] || <nowiki>[[File:SmithOP DoyleJH 1950.jpg|right|thumb|180px|<small>MajGen O.P. Smith (left) and VAdm Doyle, USN, confer on board [[USS Mount McKinley (AGC-7)]], immediately prior to the Inchon Invasion.</small>]] </nowiki>
|-
| [[:Osho (Bhagwan Shree Rajneesh)]] || <nowiki>[[File:Osho Drive By.jpg|thumb|left|300px|<small>Osho greeted by sannyasins on one of his daily "drive-bys" in Rajneeshpuram, 1982.</small>]] </nowiki>
|-
| [[:Peter MacKay]] || <nowiki>[[File:Elizabeth May.jpg|100px|thumb|<small>2008 Central Nova Green Candidate, [[Elizabeth May]]</small>]] </nowiki>
|-
| [[:Pope Clement I]] || <nowiki>[[File:Saintclementmartyr.png|left|thumb|<small>Martyrdom of St Clement by [[Fungai]]</small>]] </nowiki>
|-
| [[:Puran Chand Joshi]] || <nowiki>[[File:Meerut prisoners outside the jail.jpg|thumb|600px|right|<small>'''Portrait of 25 of Meerut Prisoners taken outside the jail'''. Backrow:(left to right) K.N. Sehgal, S.S. Josh, H.L. Hutchinson, Shaukat Usmani, B.F. Bradly, A. Prasad, P. Spratt, and G. Adhikari.Middle Row: K.R. Mitra, Gopan Chakravarthy, Kishore Lal Ghosh, K.L. Kadam, D.R. Thengdi, Goura Shanker, S. Banerjee, K.N. Joglekar, [[P.C. Joshi]], and Muzaffar Ahmed.Front Row: M.G. Desai, G. Goswami, R.S. Nimkar, S.S. Mirajkar, S.A. Dange, G.V. Ghate and Gopal Basak.</small>]] </nowiki>
|-
| [[:Ratification Day (United States)]] || <nowiki>[[File:Ratification of Treaty of Paris 1784.gif|thumb|200 px|<small>Congressional Proclamation of Ratification of Treaty of Paris, Jan 14, 1784</small>]] </nowiki>
|-
| [[:Rawtenstall]] || <nowiki>[[File:Rawtenstallbusstation 001.jpg|thumb|right|<small>Rawtenstall bus station, September 2008</small>]] </nowiki>
|-
| [[:Sabre]] || <nowiki>[[File:Marxauch Sword.jpg|left|250px|thumb|<small>Lieutenant Colonel [[Teófilo Marxuach]]'s M1902 Officer's Sabre and Scabbard at the National Historic Trust site at [[Fort San Cristobal|Castillo San Cristobal]] in San Juan.</small>]] </nowiki>
|-
| [[:Suesca]] || <nowiki>[[File:RocasDeSuesca.JPG|thumb|left|221px|thumb|<small>Rocas de Suesca, Special place to whom love climbing, traking and rafting</small>]] </nowiki>
|-
| [[:Victorinox]] || <nowiki>[[File:Soldatenmesser 08-2.JPG|thumb|150px|<small>''Soldatenmesser 08'', the knife currently issued to the Swiss military</small>]] </nowiki>
|-
| [[:Wendell Cushing Neville]] || <nowiki>[[File:Wcneville-usna-photo-01.jpg|95px|left|thumb|<small>Cadet Wendell C. Neville, U.S. Naval Academy</small>]] </nowiki>
|-
| [[:Wetzikon]] || <nowiki>[[File:Pfäffikersee.JPG|thumb|left|<small>Wetzikon as seen from [[Bachtel Tower]]. [[Pfäffikersee]] in the middle, [[Greifensee]] at the left side.</small>]] </nowiki>
|}
=== Indented list ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:1920s]] || <nowiki>:*[[Greco-Turkish War (1919–1922)|Greco-Turkish War]]</nowiki>
|-
| [[:Adaptive A*]] || <nowiki>:* '''The states in the state space:''' The states</nowiki>
|-
| [[:Azlan Ismail]] || <nowiki>:* '''Runner-up:''' 2005</nowiki>
|-
| [[:Bill Crider]] || <nowiki>:* ''Too Late to Die'' (Walker, l986; Ivy, 1989) -</nowiki>
|-
| [[:Boston University]] || <nowiki>:*[[Boston University College of Fine Arts|College</nowiki>
|-
| [[:Disrespecting the police]] || <nowiki>:* ''resisting an officer'' or ''refusing to obey'';</nowiki>
|-
| [[:Easily Slip Into Another World]] || <nowiki>:*Recorded at Mediasound Studio, New York City on September</nowiki>
|-
| [[:Gonzalo Higuaín]] || <nowiki>:* '''Winner (2):''' [[La Liga 2006-07|2006-07]], [[La</nowiki>
|-
| [[:Great Jazz Standards]] || <nowiki>:*Recorded in New York City on February 5, 1959 (tracks</nowiki>
|-
| [[:Intraconference rivalries in the American Football Conference]] || <nowiki>:*First met in 1960</nowiki>
|-
| [[:John Duncan Forsyth]] || <nowiki>:*For his firm's projects see [[Layton & Forsyth]]</nowiki>
|-
| [[:Klaudia Kovacs]] || <nowiki>:* [http://www.hollywoodreporter.com/hr/film/reviews/article_display.jsp?rid=10130&imw=Y</nowiki>
|-
| [[:Live at Koncepts]] || <nowiki>:*Recorded at Koncepts Cultural Gallery in Oakland,</nowiki>
|-
| [[:New Bottle Old Wine]] || <nowiki>:*Recorded in New York City on April 9 (tracks 1,2,5</nowiki>
|-
| [[:O'Hare International Airport]] || <nowiki>:*'''Concourse B''', with 22 gates</nowiki>
|-
| [[:Rag, Bush and All]] || <nowiki>:*Recorded at Clinton Recording Studios, New York City</nowiki>
|-
| [[:Requirements analysis]] || <nowiki>:* This abstraction makes it impossible to see how</nowiki>
|-
| [[:Semiotic elements and classes of signs (Peirce)]] || <nowiki>:* [[Charles Sanders Peirce#External_links]]. External</nowiki>
|-
| [[:Song Out of My Trees]] || <nowiki>:*Recorded at Sear Sound, New York City on August 17,</nowiki>
|-
| [[:Spirit of Nuff...Nuff]] || <nowiki>:*Recorded at R.P.M. Studios, New York City on November</nowiki>
|-
| [[:The Sheik (wrestler)]] || <nowiki>:*[[NWA North American Heavyweight Championship]]</nowiki>
|-
| [[:Tukey's test of additivity]] || <nowiki>:*[[Tukey's range test]] for multiple comparisons</nowiki>
|-
| [[:Viscometer]] || <nowiki>:*'' '' is the frictional force,</nowiki>
|-
| [[:Where Flamingos Fly]] || <nowiki>:*Recorded in New York City, 1971.</nowiki>
|-
| [[:You Know the Number]] || <nowiki>:*Recorded at Uptown Chelsea Sound, New York City on</nowiki>
|}
=== Interwiki before last category (AWB, IW, PY, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:All I Do Is Win]] || <nowiki>[[tr:Şablon:T-Pain]]</nowiki>
|-
| [[:Amelia Goes to the Ball]] || <nowiki>[[it:Amelia al ballo]]</nowiki>
|-
| [[:Athenian Army]] || <nowiki>[[es:Ejército ateniense]]</nowiki>
|-
| [[:Burmese-Siamese War (1548–49)]] || <nowiki>[[th:สงครามพระเจ้าตะเบ็งชเวตี้]]</nowiki>
|-
| [[:Cornelis de Liefde]] || <nowiki>[[nl:Cornelis de Liefde]]</nowiki>
|-
| [[:Enno Doedes Star]] || <nowiki>[[nl:Enno Doedes Star]]</nowiki>
|-
| [[:European Platform for Rehabilitation (EPR)]] || <nowiki>[[fi:European Platform for Rehabilitation (EPR)]]</nowiki>
|-
| [[:Ferenc Wesselényi]] || <nowiki>[[hu:Wesselényi Ferenc]]</nowiki>
|-
| [[:Finnish People's Delegation]] || <nowiki>[[ru:Народный Совет Финляндии]]</nowiki>
|-
| [[:Jerome Ehlers]] || <nowiki>[[de:Jerome Ehlers]]</nowiki>
|-
| [[:Jinan Great Southern Mosque]] || <nowiki>[[zh:济南清真南大寺]]</nowiki>
|-
| [[:Joel of Dotawo]] || <nowiki>[[de:Joel (Dotawo)]]</nowiki>
|-
| [[:Johan de Liefde (naval commander)]] || <nowiki>[[nl:Johan de Liefde (viceadmiraal)]]</nowiki>
|-
| [[:Korean Film Archive]] || <nowiki>[[ko:한국 영상 자료원]]</nowiki>
|-
| [[:L'Homme Qui Marche I]] || <nowiki>[[de:L'Homme Qui Marche I]]</nowiki>
|-
| [[:Marjorie's Quest]] || <nowiki>[[pl:Gwiazda przewodnia]]</nowiki>
|-
| [[:Martyrs' Square, Brussels]] || <nowiki>[[fr:Place des Martyrs (Bruxelles)]]</nowiki>
|-
| [[:Medija Castle]] || <nowiki>[[sl:Medijski grad]]</nowiki>
|-
| [[:Metton]] || <nowiki>[[fr:Metton]]</nowiki>
|-
| [[:Nhat Nam]] || <nowiki>[[vi:Nhất Nam]]</nowiki>
|-
| [[:Nordthüringgau]] || <nowiki>[[de:Nordthüringgau]]</nowiki>
|-
| [[:Plan Calcul]] || <nowiki>[[fr:Plan Calcul]]</nowiki>
|-
| [[:The Multilingual Library]] || <nowiki>[[no:Det flerspråklige bibliotek]]</nowiki>
|-
| [[:Valencian Bible]] || <nowiki>[[ca:Bíblia Valenciana]]</nowiki>
|-
| [[:Villa ten Hompel]] || <nowiki>[[de:Villa ten Hompel]]</nowiki>
|}
=== Interwiki before last headline (AWB, IW, PY, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Baltimore Colts (1947–50)]] || <nowiki>[[fr:Baltimore Colts (1947-50)]]</nowiki>
|-
| [[:Christian Palin]] || <nowiki>[[pt:Christian Palin]]</nowiki>
|-
| [[:Ciarán Hinds]] || <nowiki>[[tr:Ciarán Hinds]]</nowiki>
|-
| [[:Co-ordinated organisations]] || <nowiki>[[fr:Organisations Coordonnées]]</nowiki>
|-
| [[:Cranfield School of Management]] || <nowiki>[[no:Cranfield University]]</nowiki>
|-
| [[:Emotion & Commotion]] || <nowiki>[[ja:ジェフ (アルバム)]]</nowiki>
|-
| [[:Fares Karam]] || <nowiki>[[ar:فارس كرم]]</nowiki>
|-
| [[:Flying frog]] || <nowiki>[[it:Rana volante]]</nowiki>
|-
| [[:Hectograph]] || <nowiki>[[sv:Hektograf]]</nowiki>
|-
| [[:Jackscrew]] || <nowiki>[[nl:Schaarkrik]]</nowiki>
|-
| [[:Korean Film Archive]] || <nowiki>[[ko:한국 영상 자료원]]</nowiki>
|-
| [[:Marco Island, Florida]] || <nowiki>[[vo:Marco Island]]</nowiki>
|-
| [[:Melbourne Rebels]] || <nowiki>[[fr:Melbourne Rebels]]</nowiki>
|-
| [[:Paul Splingaerd]] || <nowiki>[[fr:Paul Splingaerd]]</nowiki>
|-
| [[:Power Pirate]] || <nowiki>[[de:Power_Pirate]]</nowiki>
|-
| [[:Sioux Falls Arena]] || <nowiki>[[it:Sioux Falls Arena]]</nowiki>
|-
| [[:Software development]] || <nowiki>[[zh:软件开发]]</nowiki>
|-
| [[:Str8 Rippin]] || <nowiki>[[de:Str8 Rippin]]</nowiki>
|-
| [[:Stroop effect]] || <nowiki>[[zh:斯特鲁普效应]]</nowiki>
|-
| [[:True Believer (1989 film)]] || <nowiki>[[ru:Верящий в правду (фильм)]]</nowiki>
|-
| [[:Tsandryphsh]] || <nowiki>[[ru:Цандрыпш]]</nowiki>
|-
| [[:Tyrone Ellis]] || <nowiki>[[it:Tyrone Ellis]]</nowiki>
|-
| [[:UNESCO Confucius Prize for Literacy]] || <nowiki>[[ca:Premi UNESCO Confucius]]</nowiki>
|-
| [[:Yamaha RD350LC]] || <nowiki>[[ja:ヤマハ・RZ]]</nowiki>
|-
| [[:Zade Dirani]] || <nowiki>[[ar:زيد ديراني]]</nowiki>
|}
=== Link with no space (AWB, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Barry Avrich]] || <nowiki>[[Media:http://www.sickkidsfoundation.com/PressReleases/downloads/News%20Release%20-%20The%20Hollywood%20Launch.pdf]] </nowiki>
|-
| [[:Hershey Breasts Bikini]] || <nowiki>[[http://scrapetv.com/News/News%20Pages/Everyone%20Else/images-2/Hershey-Breasts-Bikini.jpg]] </nowiki>
|-
| [[:Janaka Selekta]] || <nowiki>[[Media:http://janakaselekta.net/Press/35%20Electrobuzz.pdf.]] </nowiki>
|-
| [[:Kuwait Airways]] || <nowiki>[[Image:Kuwait%20Airways.jpg|thumb|Kuwait Airways [[A340]] landing]] </nowiki>
|-
| [[:List of deserts by area]] || <nowiki>[[Image:Namib%20desert%20MODIS.jpg|100px]] </nowiki>
|-
| [[:Marc L. Marks]] || <nowiki>[[Media:http://www.nytimes.com/1982/07/26/opinion/l-americans-at-the-brink-of-street-protests-036526.html?n=Top/Reference/Times%20Topics/Subjects/D/Demonstrations%20and%20Riots]] </nowiki>
|-
| [[:Tamaskan wolf dog]] || <nowiki>[[http://www.the-no-wolf-tamaskan-fable.com/Pedigree%20Summary-1.pdf Pedigree History of the Tamaskan Wolfdog]] </nowiki>
|}
=== Redirect with incorrect syntax (partial BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Wikipedia:WikiProject Council/Banner standardisation/Code]] || <nowiki>// <pre><?php$username="";$password="";$PageNames=array();$querycontinue="NONE";$querynumber=0//Getting </nowiki>
|}
=== Reference before punctuation ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:11th Marine Artillery Regiment]] || <nowiki></ref>. From 1984 to 1985, the regiment was involved</nowiki>
|-
| [[:Cagayan de Oro City]] || <nowiki></ref>. [http://www.ama-university.com/ AMA Computer</nowiki>
|-
| [[:Cerium]] || <nowiki></ref>. The photostability of pigments can be enhanced</nowiki>
|-
| [[:Fethard-on-Sea]] || <nowiki></ref>.=== The Film ===A movie, ''[[A Love Divided]]''</nowiki>
|-
| [[:John Tristram Holland]] || <nowiki></ref>. He was born into an ecclesiastical family<ref>His</nowiki>
|-
| [[:Mary Wondrausch]] || <nowiki></ref>. She is a fellow of the [[Craft Potters' Association]]</nowiki>
|-
| [[:O'Hare International Airport]] || <nowiki></ref>.In 1995, the Chicago/Gary Airport Compact</nowiki>
|-
| [[:Sodium chlorite]] || <nowiki></ref>. A dosis of 10-15 grams of [[sodium chlorate]]</nowiki>
|-
| [[:Solidarity Youth Movement, Kerala]] || <nowiki></ref>.It, along with its parent organization [[Jama-athe</nowiki>
|-
| [[:Sophie Monk]] || <nowiki></ref>. At [[MacGregor State High School]],she was</nowiki>
|-
| [[:St Helens, Merseyside]] || <nowiki></ref>.There are several restaurants in the town</nowiki>
|-
| [[:Steve Jameson]] || <nowiki></ref>.In 2009, Jameson was elected into the NATIONAL</nowiki>
|-
| [[:Steven Spielberg]] || <nowiki></ref>. One of the fatal flaws in the film is that</nowiki>
|-
| [[:Sukhoi PAK FA]] || <nowiki></ref>. The PAK FA when fully developed is intended</nowiki>
|-
| [[:Tamarind]] || <nowiki></ref>.It is widely distributed throughout the [[Tropical]]</nowiki>
|-
| [[:Telangana]] || <nowiki></ref>. The agreement provided reassurances to both</nowiki>
|-
| [[:Tham Fook Cheong]] || <nowiki></ref>.==Feng Shui==Master Tham is a well-known</nowiki>
|-
| [[:The Lady is Willing]] || <nowiki></ref>.==References=={{reflist}}== External links</nowiki>
|-
| [[:University of Seville]] || <nowiki></ref>.In the middle of the thirteenth century the</nowiki>
|-
| [[:Vinzenz Bronzin]] || <nowiki></ref>.== Publications ==* Bronzin, V: Theorie der</nowiki>
|-
| [[:William Alfred Robertson Fitchett]] || <nowiki></ref>. Ordained in 1901 <ref>”The Clergy List”</nowiki>
|-
| [[:Winter storms of 2009–2010]] || <nowiki></ref>. A [[fishing boat]] was damage at sea off the</nowiki>
|-
| [[:Winter storms of 2009–2010 in East Asia]] || <nowiki></ref>.===2009=======May 8th====21 people had died</nowiki>
|-
| [[:Zeno Sustac]] || <nowiki></ref>.Since 2009, he has been working on a doctorate</nowiki>
|-
| [[:ZNC (IRC bouncer)]] || <nowiki></ref>. Available modules comprise logging functionality,</nowiki>
|}
=== Reference list duplication ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:360networks]] || <nowiki>Western United States. ==Notes== <references /></nowiki><br /><nowiki> <references /> </nowiki>
|-
| [[:Akamas (2006 film)]] || <nowiki>Film Festival. ==References== <references/></nowiki><br /><nowiki><references/> </nowiki>
|-
| [[:Alan Lyddiard]] || <nowiki>Official website] <references/></nowiki><br /><nowiki>Official website] <references/> <references/> </nowiki>
|-
| [[:Bolte Ministry]] || <nowiki> ===References=== <references/></nowiki><br /><nowiki> ===References=== <references/> </nowiki>
|-
| [[:Charlie Albright]] || <nowiki> ==References== <references/></nowiki><br /><nowiki><references/> </nowiki>
|-
| [[:Dunbar Township Municipal Authority]] || <nowiki>awards contracts for sewage project<references/></nowiki><br /><nowiki>lines in; now road needs fixed<references/> </nowiki>
|-
| [[:Fariba Ahmadi Kakar]] || <nowiki>Committee. ==References== <references/></nowiki><br /><nowiki><references/> ==References== <references/> </nowiki>
|-
| [[:Formosa surname]] || <nowiki>politician of Maltese origin <references/></nowiki><br /><nowiki><references/> </nowiki>
|-
| [[:Fundación Proacceso ECO A.C.]] || <nowiki>centers by the end of 2011. <references/></nowiki><br /><nowiki> <references/> </nowiki>
|-
| [[:Garage Graphics]] || <nowiki>.rolanddga.com/gallery/masters/eric/<references/></nowiki><br /><nowiki>ehicleGraphics/garageGraphicsHummer/<references/> </nowiki>
|-
| [[:Garage Hop]] || <nowiki>fall under Acid Jazz. ==Notes== <references /></nowiki><br /><nowiki><references /> </nowiki>
|-
| [[:Gary Erwin]] || <nowiki>Diego, California|San Diego, CA]]<references/></nowiki><br /><nowiki>to Gary|Addicted to Gary]]<references/> </nowiki>
|-
| [[:Gus G. Widmayer]] || <nowiki>Massachusetts]]. == References == *<references/></nowiki><br /><nowiki>House, Boston, Mass. 2006.</ref> *<references/> </nowiki>
|-
| [[:Hugh stoker]] || <nowiki> He lived near Seatown in Dorset. <references/></nowiki><br /><nowiki><references/> ==References== <references /> </nowiki>
|-
| [[:International Intellectual Property Institute]] || <nowiki>of living]]. ==References== <references/></nowiki><br /><nowiki> ==References== <references/> <references/> </nowiki>
|-
| [[:Jalakantapuram Ramaswamy Krishnamoorthy]] || <nowiki>and Pharmaceuticals Pvt Ltd]</ref> <references/></nowiki><br /><nowiki>awardees (PDF - 92.5 Kb)</ref> <references/> </nowiki>
|-
| [[:Jasper Mall]] || <nowiki>==References== <references/></nowiki><br /><nowiki>eferences/>http://www.jaspermall.net<references/> </nowiki>
|-
| [[:LG CF360]] || <nowiki> ==References== <references /></nowiki><br /><nowiki>/> </nowiki>
|-
| [[:Manhattan Fencing Center]] || <nowiki>www.manhattanencing.com<references/></nowiki><br /><nowiki>www.usfencing.org<references/> </nowiki>
|-
| [[:Mohammad Gul (Helmand Council)]] || <nowiki>| quote= }}</ref> ==References== <references/></nowiki><br /><nowiki><references/> ==References== <references/> </nowiki>
|-
| [[:Mors lilla olle]] || <nowiki>(70 years). == References == <references/></nowiki><br /><nowiki><references/> </nowiki>
|-
| [[:Shakiba]] || <nowiki>[[Olumi Party]]. ==References== <references/></nowiki><br /><nowiki><references/> ==References== <references/> </nowiki>
|-
| [[:The Dirty Works]] || <nowiki>r-more-on-this-movie-check-out.html]<references/></nowiki><br /><nowiki> [http://www.myspace.com/dirtyworks]<references/> </nowiki>
|-
| [[:Top O' The River]] || <nowiki>==References== <references/></nowiki><br /><nowiki>ttp://www.topotheriverrestaurant.com<references/> </nowiki>
|-
| [[:Yough Sanitary Authority]] || <nowiki>project to begin soon<references/></nowiki><br /><nowiki>to begin on sewage project<references/> </nowiki>
|}
=== Template coding tags without content ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:88th United States Congress]] || <nowiki><includeonly></includeonly>====[[List of United States Senators from California|California]]====*</nowiki>
|-
| [[:Aladdin (soundtrack)]] || <nowiki><includeonly></includeonly> Cut lyrics from ''Aladdin'']{{Disney's Aladdin}}{{start</nowiki>
|-
| [[:Burmese gray wild dog]] || <nowiki><includeonly></includeonly>{{Infobox Paranormalcreatures|Creature_Name = Myanmar</nowiki>
|-
| [[:DVB-S2]] || <nowiki><noinclude></noinclude>based on the [[concatenated code|concatenation]] of the [[BCH</nowiki>
|-
| [[:Economy of Panama]] || <nowiki><noinclude></noinclude>'''The Economy of [[Panama]]''' is a fully dollarized <ref</nowiki>
|-
| [[:Elmira College]] || <nowiki><noinclude></noinclude>==References==Barber, William Charles (1955). ''Elmira</nowiki>
|-
| [[:European Students Conference]] || <nowiki><noinclude></noinclude>'''European Students' Conference''' (ESC) is an international</nowiki>
|-
| [[:Glory (religion)]] || <nowiki><includeonly></includeonly>'''Glory''' (from the Latin ''gloria'', "fame, renown")</nowiki>
|-
| [[:Hendrik Verwoerd]] || <nowiki><noinclude></noinclude> {{Persondata|NAME=</nowiki>
|-
| [[:International relations theory]] || <nowiki><noinclude></noinclude>[[Category:International relations theory| ]][[Category:International</nowiki>
|-
| [[:Kang Deouk-Soo]] || <nowiki><noinclude></noinclude>[[Category:1986 FIFA World Cup squad templates|Korea, South]][[Category:South</nowiki>
|-
| [[:List of Kyo Kara Maoh! characters]] || <nowiki><includeonly></includeonly>, his older brother Shori,<ref name="ep72"/> and even</nowiki>
|-
| [[:List of undefeated Division I football teams]] || <nowiki><includeonly></includeonly>===Undefeated, but with ties===These teams all finished</nowiki>
|-
| [[:National Union of Students of the United Kingdom]] || <nowiki><noinclude></noinclude>{{DEFAULTSORT:National Union Of Students Of The United Kingdom}}[[Category:Higher</nowiki>
|-
| [[:Patty Schnyder]] || <nowiki><noinclude></noinclude>==Career==In 1996, Schnyder made her [[Grand Slam (tennis)|Grand</nowiki>
|-
| [[:Pinoy Idol]] || <nowiki><noinclude></noinclude>:''For Associated Broadcasting Company's former Idol franchise,</nowiki>
|-
| [[:Salve Regina]] || <nowiki><includeonly></includeonly>:''For the university, see [[Salve Regina University]].''[[Image:Raphael</nowiki>
|-
| [[:Saroj signh]] || <nowiki><includeonly></includeonly>== Career ==Before becoming a television presenter Crawford</nowiki>
|-
| [[:Sex and the law]] || <nowiki><includeonly></includeonly>{{Redirect|Sex crime|the Eurythmics song|Sexcrime (Nineteen</nowiki>
|-
| [[:Sioux Falls Stampede]] || <nowiki><noinclude></noinclude> </nowiki>
|-
| [[:Sirikit]] || <nowiki><noinclude></noinclude>==Ancestor== </nowiki>
|-
| [[:Southwest Corridor (Minnesota)]] || <nowiki><noinclude></noinclude>{{-}}==References=={{reflist|2}}==External links==*</nowiki>
|-
| [[:Tennessee Volunteers football]] || <nowiki><includeonly></includeonly>}}The '''Tennessee Volunteers''' are an [[United States|American]]</nowiki>
|-
| [[:The Locust]] || <nowiki><noinclude></noinclude>{{DEFAULTSORT:Locust, The}}[[Category:American noise rock</nowiki>
|-
| [[:Torrey Pines High School]] || <nowiki><noinclude></noinclude> and Water Polo. On October 11, 2007, Torrey Pines football</nowiki>
|}
=== Template value ends with break (AutoEd) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:Denham Springs Freshman High School]] || <nowiki>free_1=…Shana White<br/></nowiki>
|-
| [[:French 600 Series submarines]] || <nowiki>Subclasses=…class<br/></nowiki>
|-
| [[:Hajibala Abutalybov]] || <nowiki>party=…(YAP)]] <br /></nowiki>
|-
| [[:Hamlet Mkhitaryan (born 1962)]] || <nowiki>caps(goals)=…/>112 (30)<br /></nowiki>
|-
| [[:Ilario Pantano]] || <nowiki>awards=…(2nd Award)<br/></nowiki>
|-
| [[:James Okoli]] || <nowiki>caps(goals)=…(0)<br /><br /></nowiki>
|-
| [[:Johann Heinrich von Schmidt]] || <nowiki>placeofdeath=…splay=inline}}</br></nowiki>
|-
| [[:Kalvin Morath-Gibbs]] || <nowiki>caps(goals)=…{{0}}20 (1)<br /></nowiki>
|-
| [[:Lucrate Milk]] || <nowiki>Genre=…rock|Punk]]<br/></nowiki>
|-
| [[:Marshua]] || <nowiki>race=…Oaks]] (1965)<br></nowiki>
|-
| [[:MC Gaming]] || <nowiki>key_people=…co-founder)<br /></nowiki>
|-
| [[:P2i]] || <nowiki>company_type=…/></nowiki>
|-
| [[:Paratrooper Battalion 261 (Germany)]] || <nowiki>battles=…Oqab]]<br></nowiki>
|-
| [[:Peter Van Loan]] || <nowiki>honorific-prefix=…rable]]</small><br></nowiki>
|-
| [[:Psychosiz]] || <nowiki>Associated_acts=…Blowed]]'''<br /></nowiki>
|-
| [[:Quino Cabrera]] || <nowiki>caps(goals)=…/>71 {{0}}(7)<br /></nowiki>
|-
| [[:Ramón Pereira]] || <nowiki>caps(goals)=…(0)<br /><br /></nowiki>
|-
| [[:Roberto Matute]] || <nowiki>caps(goals)=…/><br /><br /></nowiki>
|-
| [[:Roman Voynarovskyy]] || <nowiki>caps(goals)=…/>10 (2)<br /></nowiki>
|-
| [[:Salvador Capín]] || <nowiki>caps(goals)=…(0)<br /><br /></nowiki>
|-
| [[:Sherman Dillard]] || <nowiki>CoachYears=…/>1997–2004<br /></nowiki>
|-
| [[:Tan Ah Eng]] || <nowiki>honorific-prefix=…ormat]]</small><br></nowiki>
|-
| [[:The Good Guy (film)]] || <nowiki>starring=…Yoo]] <br></nowiki>
|-
| [[:Tiago Jonas Ferraz Rodrigues]] || <nowiki>caps(goals)=…/>33 (3)<br /></nowiki>
|-
| [[:VisualSonics]] || <nowiki>key_people=…officer|CSO]]<br /></nowiki>
|}
=== Title linked in text (AWB, AutoEd, BOT) ===
{| class="wikitable sortable"
! article
! info
|-
|-
| [[:2010 Atlantic hurricane season]] || <nowiki>[[2010 Atlantic hurricane season|2010]], [[Lists of</nowiki>
|-
| [[:2010 Fed Cup Europe/Africa Zone Group 1 - Pool D]] || <nowiki>[[2010 Fed Cup Europe/Africa Zone Group 1 - Pool D|Pool</nowiki>
|-
| [[:Double down (sandwich)]] || <nowiki>[[Double down (sandwich)]]</nowiki>
|-
| [[:Eastern Airlines Flight 45]] || <nowiki>[[Eastern Airlines Flight 45|Flight 45]] from [[Washington,</nowiki>
|-
| [[:Electro Wave Human Tackle]] || <nowiki>[[Electro Wave Human Tackle]]|電波人間タックル|Denpa</nowiki>
|-
| [[:Emancipation (Nu Virgos album)]] || <nowiki>[[Emancipation (Nu Virgos album)|Emancipation]] |</nowiki>
|-
| [[:I. Stanford Jolley]] || <nowiki>[[I. Stanford Jolley|Isaac Stanford Jolley]]| birthname</nowiki>
|-
| [[:INgage Networks]] || <nowiki>[[INgage Networks]] headquarters in [[Naples, Florida]].]]Neighborhood</nowiki>
|-
| [[:Intermediate calibers]] || <nowiki>[[Intermediate calibers]]</nowiki>
|-
| [[:Le Classique]] || <nowiki>[[Le Classique]]''' ''(The Classic)'' is a football</nowiki>
|-
| [[:Lemonade (Gucci Mane song)]] || <nowiki>[[Lemonade (Gucci Mane song)|Lemonade]]<br/>(2009)|</nowiki>
|-
| [[:May Day protests]] || <nowiki>[[May Day protests]] {{R from other casing}}</nowiki>
|-
| [[:Monofenestrata]] || <nowiki>[[Monofenestrata]]'''| unranked_familia_authority</nowiki>
|-
| [[:One Wide River To Cross]] || <nowiki>[[One Wide River To Cross]]''<br/> (1971)| Next album</nowiki>
|-
| [[:Palestine EP]] || <nowiki>[[Palestine EP]]'''''<br/> (2010)| Next album = ''[[Dust</nowiki>
|-
| [[:Play It Like It Is]] || <nowiki>[[Play It Like It Is]]''<br/> (1969)| Next album </nowiki>
|-
| [[:Polarized light pollution]] || <nowiki>[[Polarized light pollution]]'''<ref name=PolarizedLightEnv>Gábor</nowiki>
|-
| [[:Pouilly Fume AOC]] || <nowiki>[[Pouilly Fume AOC]]</nowiki>
|-
| [[:Sound Off]] || <nowiki>[[Sound Off]]''<br/> (1971)| Next album = ''[[The</nowiki>
|-
| [[:South Division One (shinty)]] || <nowiki>[[South Division One (shinty)|South Division One]]</nowiki>
|-
| [[:The Spirit of Islam]] || <nowiki>[[The Spirit of Islam]]'', is probably the best achievement</nowiki>
|-
| [[:Traveler And Other Favorites]] || <nowiki>[[Traveler And Other Favorites]]''<br/> (1968)| Next</nowiki>
|-
| [[:Watercat M14 class landing craft]] || <nowiki>[[Watercat M14 class landing craft]]== References</nowiki>
|-
| [[:Whitney Motorsports]] || <nowiki>[[Whitney Motorsports]] in 2010]== External links</nowiki>
|-
| [[:Zeiten ändern dich]] || <nowiki>[[Zeiten ändern dich]]'' is the film adaption of his</nowiki>
|}
[[af:Wikipedia:WikiProject Check Wikipedia]]
[[ar:ويكيبيديا:فحص ويكيبيديا]]
[[ca:Viquipèdia:WikiProject Check Wikipedia]]
[[cs:Wikipedie:WikiProjekt Check Wikipedia]]
[[cy:Wicipedia:WikiProject Check Wikipedia]]
[[da:Wikipedia:WikiProjekt Check Wikipedia]]
[[de:Wikipedia:WikiProjekt Syntaxkorrektur]]
[[eo:Projekto:Check Wikipedia]]
[[es:Wikiproyecto:Check Wikipedia]]
[[fi:Wikipedia:Wikiprojekti Check Wikipedia]]
[[fr:Projet:Correction syntaxique]]
[[fy:Meidogger:Stefan Kühn/WikiProject Check Wikipedia]]
[[he:ויקיפדיה:Check Wikipedia]]
[[hu:Wikipédia:Ellenőrzőműhely]]
[[id:Wikipedia:ProyekWiki Cek Wikipedia]]
[[is:Wikipedia:WikiProject Check Wikipedia]]
[[it:Wikipedia:Elenchi generati offline/Check Wikipedia]]
[[ja:Wikipedia:ウィキプロジェクト ウィキ文法のチェック]]
[[la:Vicipaedia:WikiProject Check Wikipedia]]
[[nds:Wikipedia:WikiProject Check Wikipedia]]
[[nds-nl:Wikipedie:WikiProject Check Wikipedia]]
[[nl:Wikipedia:Wikiproject/Check Wikipedia]]
[[no:Wikipedia:WikiProject Check Wikipedia]]
[[pdc:Wikipedia:WikiProject Check Wikipedia]]
[[pl:Wikiprojekt:Check Wikipedia]]
[[pt:Wikipedia:Projetos/Check Wikipedia]]
[[ro:Wikipedia:WikiProject Check Wikipedia]]
[[ru:Википедия:Страницы с ошибками в викитексте]]
[[sk:Wikipédia:WikiProjekt Check Wikipedia]]
[[sv:Wikipedia:Projekt wikifiering/Syntaxfel]]
[[tr:Vikipedi:Vikipedi proje kontrolü]]
[[uk:Вікіпедія:Проект:Check Wikipedia]]
[[zh:维基百科:错误检查专题]]